Dermokine (DMKN) (NM_033317) Human 3' UTR Clone

CAT#: SC204547

3`UTR clone of dermokine (DMKN) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DMKN
• Synonyms: UNQ729; ZD52F10
• ACCN: NM_033317
• Insert Size: 309
• Sequence Data:
  Insert Sequence

  >SC204547 3'UTR clone of NM_033317
  The sequence shown below is from the reference sequence of NM_033317. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGGGTGAAGTTTTGGTAGGCAATTTCTTGCAACCACCACCGAGGCCCCGAAAAGCACTGGTCGTCAGGGA
  GCTCCTCCCCTTGGCCCCCAGCCTGTGCCAGCCCTGGCCCGGCTGCCACACCTCTGTTTCCTAGGCTGGG
  GACCCAGCTTGTCTCTCCTTGTTTCTTCCCACTGCACTGTGGTGCTTCAGTGGCCACCAGCCTCGTCACA
  TACACCAGCATCTTTCTGTACCTCCTCCCTTTGGTGACCTGAAGTCACTGTGACAGTTCTCCAGGAAGGA
  GGAGCTTCCTACTTTTGAGTTTCTCTGTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_033317.3
• Summary: This gene is upregulated in inflammatory diseases, and it was first observed as expressed in the differentiated layers of skin. The most interesting aspect of this gene is the differential use of promoters and terminators to generate isoforms with unique cellular distributions and domain components. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
• Locus ID: 93099