CDK8 (NM_001260) Human 3' UTR Clone

CAT#: SC204721

3`UTR clone of cyclin-dependent kinase 8 (CDK8) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CDK8
• Synonyms: K35
• ACCN: NM_001260
• Insert Size: 343 bp
• Sequence Data:
  Insert Sequence

  >SC204721 3'UTR clone of NM_001260
  The sequence shown below is from the reference sequence of NM_001260. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGACACATCGGTACTGAGCTGCATCGGAATCTTGTCCATGCACTGTTGCGAATGCTGCAGGGCTGACTG
  TGCAGCTCTCTGCGGGAACCTGGTATGGGCCATGAGAATGTACTGTACAACCACATCTTCAAAATGTCCA
  GTAGCCAAGTTCCACCACTTTTCACAGATTGGGGTAGTGGCTTCCAAGTTGTACCTATTTTGGAGTTAGA
  CTTGAAAAGAAAGTGCTAGCACAGTTTGTGTTGTGGATTTGCTACTTCCATAGTTTACTTGACATGGTTC
  AGACTGACCAATGCATTTTTTTCAGTGACAGTCTGTAGCAGTTGAAGCTGTGAATGTGCTAGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001260.1
• Summary: 'This gene encodes a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are known to be important regulators of cell cycle progression. This kinase and its regulatory subunit, cyclin C, are components of the Mediator transcriptional regulatory complex, involved in both transcriptional activation and repression by phosphorylation of the carboxy-terminal domain of the largest subunit of RNA polymerase II. This kinase regulates transcription by targeting the cyclin-dependent kinase 7 subunits of the general transcription initiation factor IIH, thus providing a link between the Mediator complex and the basal transcription machinery. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]'
• Locus ID: 1024