SLC27A6 (NM_001017372) Human 3' UTR Clone

CAT#: SC204854

3`UTR clone of solute carrier family 27 (fatty acid transporter) member 6 (SLC27A6) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SLC27A6
• Synonyms: ACSVL2; FACVL2; FATP6; VLCS-H1
• ACCN: NM_001017372
• Insert Size: 386
• Sequence Data:
  Insert Sequence

  >SC204854 3'UTR clone of NM_001017372
  The sequence shown below is from the reference sequence of NM_001017372. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCAGGGAACTTTATGATCAAATAATGTTAGGGGAAATAAAACTTTAAGATTTTTATATCTAGAACTTTCA
  TATGCTTTCTTAGGAAGAGTGAGAGGGGGGTATATGATTCTTTATGAAATGGGGAAAGGGAGCTAACATT
  AATTATGCATGTACTATATTTCCTTAATATGAGAGATAATTTTTTAATTGCATAAGAATTTTAATTTCTT
  TTAATTGATATAAACAGTAGTTGATTATTCTTTTTATCTATTTGGAGATTCAGTGCATAACTAAGTATTT
  TCCTTAATACTAAAGATTTTAAATAATAAATAGTGGCTAGCGGTTTGGACAATCACTAAAAATGTACTTT
  CTAATAAGTAAAATTTCTAATTTTGAATAAAAGATT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001017372.1
• Summary: This gene encodes a member of the fatty acid transport protein family (FATP). FATPs are involved in the uptake of long-chain fatty acids and have unique expression patterns. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
• Locus ID: 28965