Transcription termination factor 1 (TTF1) (NM_007344) Human 3' UTR Clone

CAT#: SC204934

3`UTR clone of transcription termination factor RNA polymerase I (TTF1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TTF1
• Synonyms: TTF-1; TTF-I
• ACCN: NM_007344
• Insert Size: 391 bp
• Sequence Data:
  Insert Sequence

  >SC204934 3'UTR clone of NM_007344
  The sequence shown below is from the reference sequence of NM_007344. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTCCAGTACTTTGGGAGGCCAAGGCCGGTGGATCATCTGAGGTCAGGAGTTCGAGACCGGCCTGACCAAC
  ATGGTGAAGACCTGTCACTATTAAAAATGCGAAAATTAGCCGGGTGTGGTAGTGCACACCTGTAATTTCA
  ACTACTTGGGAGGCTGAGGCAGGAGAATTGCTTGAACCCAGGAGGTGGAGGTTGCAGTGAGCCAAGATCG
  CACCACCGCATGAGAGAGAGAGATTACTATTTCTTGTCCCTTTTTCTCAGTTTGATTATATTTATATACA
  TATGTCAGTAAATCTGTTTTCAGTATTGATGTTTAATAAAGAATGTACAATGGCCAGAGTTCTACTCTTT
  CCTCTGGAGCATTAAAATATATTGCCATTCCTATTAAAACG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_007344.2
• Summary: 'This gene encodes a transcription termination factor that is localized to the nucleolus and plays a critical role in ribosomal gene transcription. The encoded protein mediates the termination of RNA polymerase I transcription by binding to Sal box terminator elements downstream of pre-rRNA coding regions. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. This gene shares the symbol/alias 'TFF1' with another gene, NK2 homeobox 1, also known as thyroid transcription factor 1, which plays a role in the regulation of thyroid-specific gene expression. [provided by RefSeq, Apr 2011]'
• Locus ID: 7270