DPS1 (PDSS1) (NM_014317) Human 3' UTR Clone

CAT#: SC205171

3`UTR clone of prenyl (decaprenyl) diphosphate synthase subunit 1 (PDSS1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PDSS1
• Synonyms: COQ1; COQ1A; COQ10D2; DPS; hDPS1; SPS; TPRT; TPT; TPT 1
• ACCN: NM_014317
• Insert Size: 341
• Sequence Data:
  Insert Sequence

  >SC205171 3'UTR clone of NM_014317
  The sequence shown below is from the reference sequence of NM_014317. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGCCCTCATTCAGCTTTCAGAAATTGTACTCACAAGAGATAAATGACAACTCTTTCTGTTCTTTCTGGCA
  GCTATCTTACCAGACTGTGCCTAAAGAATTTTGTGGAATACACTTTGTTTGCTTCATGTGCAGATAACCA
  AAAATCATTTTAAAAGATATCAAACTTATTGATGGGCAATTTATTTTTTTTTATTGCAAAAGTTTTTTCA
  GAAAACTTTTTAAATGTAATTAATAAACCACCTGAATCTGTCATTCTAGTCCTATAAATTATAATCAAGG
  TATCTTGATGGTTATATGTGGTATTGTTTACACTGTTAATATCCACATGTAAGGCCATTAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_014317.3
• Summary: The protein encoded by this gene is an enzyme that elongates the prenyl side-chain of coenzyme Q, or ubiquinone, one of the key elements in the respiratory chain. The gene product catalyzes the formation of all trans-polyprenyl pyrophosphates from isopentyl diphosphate in the assembly of polyisoprenoid side chains, the first step in coenzyme Q biosynthesis. The protein may be peripherally associated with the inner mitochondrial membrane, though no transit peptide has been definitively identified to date. Defects in this gene are a cause of coenzyme Q10 deficiency. [provided by RefSeq, Jul 2008]
• Locus ID: 23590