CCR4 (NM_005508) Human 3' UTR Clone

CAT#: SC205449

3`UTR clone of chemokine (C-C motif) receptor 4 (CCR4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CCR4
• Synonyms: CC-CKR-4; CD194; ChemR13; CKR4; CMKBR4; HGCN:14099; K5-5
• ACCN: NM_005508
• Insert Size: 439 bp
• Sequence Data:
  Insert Sequence

  >SC205449 3'UTR clone of NM_005508
  The sequence shown below is from the reference sequence of NM_005508. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTTACACGCAGTCCACCATGGATCATGATCTCCATGATGCTCTGTAGAAAAATGAAATGGTGAAATGCAG
  AGTCAATGAACTTTCCACATTCAGAGCTTACTTAAAATTGTATTTTAGTAAGAGATTCCTGAGCCAGTGT
  CAGGAGGAAGGCTTACACCCACAGTGGAAAGACAGCTTCTCATCCTGCAGGCAGCTTTTTCTCTCCCACT
  AGACAAGTCCAGCCTGGCAAGGGTTCACCTGGGCTGAGGCATCCTTCCTCACACCAGGCTTGCCTGCAGG
  CATGAGTCAGTCTGATGAGAACTCTGAGCAGTGCTTGAATGAAGTTGTAGGTAATATTGCAAGGCAAAGA
  CTATTCCCTTCTAACCTGAACTGATGGGTTTCTCCAGAGGGAATTGCAGAGTACTGGCTGATGGAGTAAA
  TCGCTACCTTTTGCTGTGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005508.4
• Summary: 'The protein encoded by this gene belongs to the G-protein-coupled receptor family . It is a receptor for the CC chemokine - MIP-1, RANTES, TARC and MCP-1. Chemokines are a group of small polypeptide, structurally related molecules that regulate cell trafficking of various types of leukocytes. The chemokines also play fundamental roles in the development, homeostasis, and function of the immune system, and they have effects on cells of the central nervous system as well as on endothelial cells involved in angiogenesis or angiostasis. [provided by RefSeq, Jul 2008]'
• Locus ID: 1233