ATF6 (NM_007348) Human 3' UTR Clone

CAT#: SC205479

3`UTR clone of activating transcription factor 6 (ATF6) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ATF6
• Synonyms: ACHM7; ATF6A
• ACCN: NM_007348
• Insert Size: 420
• Sequence Data:
  Insert Sequence

  >SC205479 3'UTR clone of NM_007348
  The sequence shown below is from the reference sequence of NM_007348. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCACGTTGTCAGCACCATCCCTGAGTCATTACAATAGCACCCTGCAGCTATGCTGGAAAACTGAGCGTGG
  GACCCTGCCAGACTGAAGAGCAGGTGAGCAAAATGCTGCTTTCTGCCTTGGTGGCAGGCAGAGAACTGTC
  TCGTACTAGAATTCAAGGAGGAAAGAAGAAGAAATAAAAGAAGCTGCTCCATTTTTCATCATCTACCCAT
  CTATTTGGAAAGCACTGGAATTCAGATGCAAGAGAACAATGTTTCTTCAGTGGCAAATGTAGCCCTGCAT
  CCTCCAGTGTTACCTGGTGTAGATTTTTTTTTCTGTACCTTTCTAAACCTCTCTTCCCTCTGTGATGGTT
  TTGTGTTTAAACAGTCATCTTCTTTTAAATAATATCCACCTCTCCTTTTTGCCATTTCACTTATTGATTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_007348.2
• Summary: This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
• Locus ID: 22926