Aldolase C (ALDOC) (NM_005165) Human 3' UTR Clone

CAT#: SC205743

3`UTR clone of aldolase C fructose-bisphosphate (ALDOC) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ALDOC
• Synonyms: ALDC
• ACCN: NM_005165
• Insert Size: 435 bp
• Sequence Data:
  Insert Sequence

  >SC205743 3'UTR clone of NM_005165
  The sequence shown below is from the reference sequence of NM_005165. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CACAGTCACTCTACATTGCCAACCATGCCTACTGAGTATCCACTCCATACCACAGCCCTTGGCCCAGCCA
  TCTGCACCCACTTTTGCTTGTAGTCATGGCCAGGGCCAAATAGCTATGCAGAGCAGAGATGCCTTCACCT
  GGCACCAACTTGTCTTCCTTTCTCTCTTCCCTTCCCCTCTCTCATTGCTGCACCTGGGACCATAGGATGG
  GAGGATAGGGAGCCCCTCATGACTGAGGGCAGAAGAAATTGCTAGAAGTCAGAACAGGATGGCTGGGTCT
  CCCCCTACCTCTTCCAGCTCCCACAATTTTCCCATGATGAGGTAGCTTCTCCCTGGGCTCTCCTTCTTGC
  CTGCCCTGTCTCCTGGGATCAGAGGGTAGTACAGAAGCCCTGACTCATGCCTTGAGTACATACCATACAG
  CAAATAAATGGTAGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005165.2
• Summary: 'This gene encodes a member of the class I fructose-biphosphate aldolase gene family. Expressed specifically in the hippocampus and Purkinje cells of the brain, the encoded protein is a glycolytic enzyme that catalyzes the reversible aldol cleavage of fructose-1,6-biphosphate and fructose 1-phosphate to dihydroxyacetone phosphate and either glyceraldehyde-3-phosphate or glyceraldehyde, respectively. [provided by RefSeq, Jul 2008]'
• Locus ID: 230