LHX2 (NM_004789) Human 3' UTR Clone

CAT#: SC206152

3`UTR clone of LIM homeobox 2 (LHX2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LHX2
• Synonyms: hLhx2; LH2
• ACCN: NM_004789
• Insert Size: 486
• Sequence Data:
  Insert Sequence

  >SC206152 3'UTR clone of NM_004789
  The sequence shown below is from the reference sequence of NM_004789. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTCACAAACGACTCTTACCAACCTTTTCTAATGACTCGCAACCCCTCACCCCACAATTTCTTTAAAAAA
  GAAATTATCTTTAGTTGAATTCCAAGTGTATTTTAAAATAGAGGCTTTGAGCAACTAACTAACCACATTT
  TAGGATCTCGCCTGGAAACAGAGGTAAAAAAAAGAAGTGTGCGCCCGGCTAATGCAGCGGTGTGGACCGA
  GGAACAACTTGGAAGATCTACCTGCAACACAACATTTGTGTCACTGTACAGTTTTGTGGACTGAGCGAGG
  AAAAACAACAAATAATTTAAGTTGGCTAGAGCTTCTGTATTTTCAAAGACTGCCACGTGCCTTAGGAATA
  CTGTTTTATCTCCATACTTTGGATGACTTGTTCATTTTTCTCTCCCTCTTTTTCTCTGTATATTTATGAC
  CAGAGCAAAAATGTAAAAAACAAAAAAAACAACAAAAAAAGTTTGTTACTTTGAATAGTCCTAAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_004789.3
• Summary: This gene encodes a protein belonging to a large protein family, members of which carry the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein may function as a transcriptional regulator. The protein can recapitulate or rescue phenotypes in Drosophila caused by a related protein, suggesting conservation of function during evolution. [provided by RefSeq, Jul 2008]
• Locus ID: 9355