KIR2.3 (KCNJ4) (NM_152868) Human 3' UTR Clone

CAT#: SC206334

3`UTR clone of potassium inwardly-rectifying channel subfamily J member 4 (KCNJ4) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: KCNJ4
• Synonyms: HIR; HIRK2; HRK1; IRK-3; IRK3; Kir2.3
• ACCN: NM_152868
• Insert Size: 503 bp
• Sequence Data:
  Insert Sequence

  >SC206334 3'UTR clone of NM_152868
  The sequence shown below is from the reference sequence of NM_152868. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTGGACAACATCTCCTACCGCAGGGAGTCTGCCATCTGACCTCCAGGCCCGGCCCTCACCACTGCCCACA
  AGAGCCTCTGCCGGGGGTGGGATGCCAGGACACCCCCTCCCACACTCAGGACAGAGCCAACCCTGGCTCC
  GTGGACCTTCTGGAGGAAGGTGGGGGTTTCAAAGACTGGGGGACCCCTTCCTCCTGACTCCAGCACCCAG
  GCCTGGGAAGAGCTCGGCCCCGATCAGCCTGAGTTCCGCCAGCGCCTACTTCTGGTGGCTCTAGGTCCCC
  GGATCCACCACCCTTCCCCCACTGACTCTTCAAGGACGTGCCCTCTTTGCTCTCAGAACCTTGGGGAAGG
  TGGCTGGACTGCTGGGCGGGGGACATCTCGGGGTTTCAGGGTGGGCAGGGGGTTAGTTTGGGGAGGGGGG
  GGTGCGTTTCTTTTGCATGACTGTGGCCTGTTGCTCATGACTTTCTTTTGTAAATATCTATAAATGGAGA
  CAGATGGAGACAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_152868.1
• Summary: 'Several different potassium channels are known to be involved with electrical signaling in the nervous system. One class is activated by depolarization whereas a second class is not. The latter are referred to as inwardly rectifying K+ channels, and they have a greater tendency to allow potassium to flow into the cell rather than out of it. This asymmetry in potassium ion conductance plays a key role in the excitability of muscle cells and neurons. The protein encoded by this gene is an integral membrane protein and member of the inward rectifier potassium channel family. The encoded protein has a small unitary conductance compared to other members of this protein family. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 3761