BLK (NM_001715) Human 3' UTR Clone

CAT#: SC207284

3`UTR clone of B lymphoid tyrosine kinase (BLK) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: BLK
• Synonyms: MODY11
• ACCN: NM_001715
• Insert Size: 519 bp
• Sequence Data:
  Insert Sequence

  >SC207284 3'UTR clone of NM_001715
  The sequence shown below is from the reference sequence of NM_001715. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCACCGAGCGGCAGTACGAGCTGCAGCCCTAGCCGGCCGCGCCCGCCTGCGCCCCGTGCCCACCTCTGC
  GCGGACGACCCCGACTTCCGTGCCATCCCAGACGGGCCGCGAAGGCGGGGTGTCGCCTGTGCCCTTTTCT
  CAGACCCGGAATCCAGTGGGCAGAGGCAGCTTCGCAGGGGGTCCCCGGACGGACTCCTTCACCGACTGCA
  CCCCCGGGCGAGTTACGCGGCCTCTCTGTGCCGCTTCATTTGTAGAGGGCTGTAACAGTGACCTCGCACG
  GTCATCCGGAGTACTAAGCCCCAGTAAGGTGTTCAGGACTGGTAAGCGACTGTCATCAAGTAAGGCCCCC
  GTGCTGGGCACCCCCCGTGCTGGCCGCGTCCCCGCCTCTGCGCCCTGCGTGGACCCCGCCCTGCCCCGCT
  ACAGAAGCCAGACTGGGTCCCGCGGACGCCAGCAGGGGCAGCCCCAGCCTAGGCTGCGCTCCAGCACTGC
  GGGGCTTTTCTGCAATAAAGTCACGAGCG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001715.2
• Summary: 'This gene encodes a nonreceptor tyrosine-kinase of the src family of proto-oncogenes that are typically involved in cell proliferation and differentiation. The protein has a role in B-cell receptor signaling and B-cell development. The protein also stimulates insulin synthesis and secretion in response to glucose and enhances the expression of several pancreatic beta-cell transcription factors. [provided by RefSeq, Aug 2010]'
• Locus ID: 640