MAGEA4 (NM_001011548) Human 3' UTR Clone

CAT#: SC207397

3`UTR clone of melanoma antigen family A 4 (MAGEA4) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MAGEA4
• Synonyms: CT1.4; MAGE-41; MAGE-X2; MAGE4; MAGE4A; MAGE4B
• ACCN: NM_001011548
• Insert Size: 555 bp
• Sequence Data:
  Insert Sequence

  >SC207397 3'UTR clone of NM_001011548
  The sequence shown below is from the reference sequence of NM_001011548. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCAGCTTTGTTAGAGGAGGAAGAGGGAGTCTGAGCATGAGTTGCAGCCAGGGCTGTGGGGAAGGGGCAGG
  GCTGGGCCAGTGCATCTAACAGCCCTGTGCAGCAGCTTCCCTTGCCTCGTGTAACATGAGGCCCATTCTT
  CACTCTGTTTGAAGAAAATAGTCAGTGTTCTTAGTAGTGGGTTTCTATTTTGTTGGATGACTTGGAGATT
  TATCTCTGTTTCCTTTTACAATTGTTGAAATGTTCCTTTTAATGGATGGTTGAATTAACTTCAGCATCCA
  AGTTTATGAATCGTAGTTAACGTATATTGCTGTTAATATAGTTTAGGAGTAAGAGTCTTGTTTTTTATTC
  AGATTGGGAAATCCGTTCTATTTTGTGAATTTGGGACATAATAACAGCAGTGGAGTAAGTATTTAGAAGT
  GTGAATTCACCGTGAAATAGGTGAGATAAATTAAAAGATACTTAATTCCCGCCTTATGCCTCAGTCTATT
  CTGTAAAATTTAAAAAATATATATGCATACCTGGATTTCCTTGGCTTCGTGAATGTAAGAGAAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001011548.1
• Summary: 'This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. Several variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2020]'
• Locus ID: 4103