CLNS1A (NM_001293) Human 3' UTR Clone

CAT#: SC207621

3`UTR clone of chloride channel nucleotide-sensitive 1A (CLNS1A) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CLNS1A
• Synonyms: CLCI; CLNS1B; ICln
• ACCN: NM_001293
• Insert Size: 600 bp
• Sequence Data:
  Insert Sequence

  >SC207621 3'UTR clone of NM_001293
  The sequence shown below is from the reference sequence of NM_001293. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CACCAACAGTTGCTGGACAGTTTGAGGATGCAGATGTTGATCACTGAAAATGATTTATGCAAGTTTAAGA
  TTCTGCTCCTAAGTGTAGGAGAGAACTTGGTGCCTCTTCCACTCTGGAGTGAAGTTAATGAAAGTCTTTT
  TCCTTTTCCAAAACCCAACCTGAACCAGTTCTTTCTTGAGACAGACTATACTGAGACAACAAGTTGTCAC
  CAGCAGAAGATAGATAATATGACCTTTATTAACTTGATGAATTAACTTAACCAAGAGGGTATTTGTAGTT
  TACTATTTACCCTAAAACTTTCTGTGTCTGGGTACCCTCTGAGTAGGCCTATAATTCCTACCTTGACTGT
  GTGCATCATTTGTAAGCTAGCAGATCTATGTGGTGAAAATGCACAGGAGCTTGGTAGACTGCGGGGGAAA
  GAGAGAGCTCCTTTCGCCATGTTTTACCAGTCTGCTGTTATAACCTCTTAGGTTGTATCCTTTAATTTCC
  AGCCTTTTAGGTTAGTTTCTGTAACAGAACAAGTGAGTCTGGGATGAAGTCCTCAAAGTACTTCAAATGG
  TAATTGTTTTGTTTTTGTAATAGCTTAACAAATAAACCTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001293.2
• Summary: 'This gene encodes a protein that functions in multiple regulatory pathways. The encoded protein complexes with numerous cytosolic proteins and performs diverse functions including regulation of small nuclear ribonucleoprotein biosynthesis, platelet activation and cytoskeletal organization. The protein is also found associated with the plasma membrane where it functions as a chloride current regulator. Pseudogenes of this gene are found on chromosomes 1, 4 and 6. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015]'
• Locus ID: 1207