SLC33A1 (NM_004733) Human 3' UTR Clone

CAT#: SC208277

3`UTR clone of solute carrier family 33 (acetyl-CoA transporter) member 1 (SLC33A1) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "SLC33A1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol SLC33A1
Synonyms ACATN; AT-1; AT1; CCHLND; SPG42
ACCN NM_004733
Insert Size 656
Sequence Data
>SC208277 3'UTR clone of NM_004733
The sequence shown below is from the reference sequence of NM_004733. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GAAGGATCATCTTCGTGGAAATGCAAAAGGAACAATTAATATATATGCTACTGGACATTCTAGCAAGGTA
ATTGTAGTTTAGTTTTAATTCGGAGAGCAATGATAATCAGTGCACAGGAGTATAAAATATTATTTTAAAC
AGCGAAATTAATAATATAAAATGCCAAATGGTTGAAAAAATAGAAACCTTTCTGTATATTTGATCATATT
TTTTTTTTGCCTTGTCAATGTATTTAAAGTTTACTTAAGGTCAGGAAATTCTAAAACAACTTTTCTGGCC
TTGTTATTTGATGTATATCTTTTAAATTTACTGACCAAAGCATGTTTTAAGCTGCAATGCAGTAGTCACG
GGTGGTAACCATGTAGTCAGGTATTGTTATTAGTACCTATCACTGCTGAGCTGTATTTAAAATTTTGGTA
CAATATATAAAATGGAGAAGAGCTTGATATTCAGGTACTAACCACAACTAGTCTGACATTGTTGGCAGTT
AAAATCTTATTTTGAATTGTAAATTAGTTAAATTTTATGTGGAATTTGCTGAGAAAAGAATATAGACTAC
TGAAATGTCATTTTAGTTATTTTTCTTATGACCACATTGTACAAATGAATCTGTGTTAAAAAGACTATTT
TAAATGTATTTCCTGCTTTTGTAAGC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004733.2
Summary The protein encoded by this gene is required for the formation of O-acetylated (Ac) gangliosides. The encoded protein is predicted to contain 6 to 10 transmembrane domains, and a leucine zipper motif in transmembrane domain III. Defects in this gene have been reported to cause spastic paraplegia autosomal dominant type 42 (SPG42) in one Chinese family, but not in similar patients of European descent. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2010]
Locus ID 9197

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.