Heparin Cofactor II (SERPIND1) (NM_000185) Human 3' UTR Clone

CAT#: SC208719

3`UTR clone of serpin peptidase inhibitor clade D (heparin cofactor) member 1 (SERPIND1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SERPIND1
• Synonyms: D22S673; HC2; HCF2; HCII; HLS2; LS2; THPH10
• ACCN: NM_000185
• Insert Size: 670 bp
• Sequence Data:
  Insert Sequence

  >SC208719 3'UTR clone of NM_000185
  The sequence shown below is from the reference sequence of NM_000185. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCTGCTCTTCATGGGAAGAGTGGCCAACCCCAGCAGGTCCTAGAGGTGGAGGTCTAGGTGTCTGAAGTG
  CCTTGGGGGCACCCTCATTTTGTTTCCATTCCAACAACGAGAACAGAGATGTTCTGGCATCATTTACGTA
  GTTTACGCTACCAATCTGAATTCGAGGCCCATATGAGAGGAGCTTAGAAACGACCAAGAAGAGAGGCTTG
  TTGGAATCAATTCTGCACAATAGCCCATGCTGTAAGCTCATAGAAGTCACTGTAACTGTAGTGTGTCTGC
  TGTTACCTAGAGGGTCTCACCTCCCCACTCTTCACAGCAAACCTGAGCAGCGCGTCCTAAGCACCTCCCG
  CTCCGGTGACCCCATCCTTGCACACCTGACTCTGTCACTCAAGCCTTTCTCCACCAGGCCCCTCATCTGA
  ATACCAAGCACAGAAATGAGTGGTGTGACTAATTCCTTACCTCTCCCAAGGAGGGTACACAACTAGCACC
  ATTCTTGATGTCCAGGGAAGAAGCCACCTCAAGACATATGAGGGGTGCCCTGGGCTAATGTTAGGGCTTA
  ATTTTCTCAAAGCCTGACCTTTCAAATCCATGATGAATGCCATCAGTCCCTCCTGCTGTTGCCTCCCTGT
  GACCTGGAGGACAGTGTGTGCCATGTCTCCCATACTAGAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000185.3
• Summary: 'This gene belongs to the serpin gene superfamily. Serpins play roles in many processes including inflammation, blood clotting, and cancer metastasis. Members of this family have highly conserved secondary structures with a reactive center loop that interacts with the protease active site to inhibit protease activity. This gene encodes a plasma serine protease that functions as a thrombin and chymotrypsin inhibitor. The protein is activated by heparin, dermatan sulfate, and glycosaminoglycans. Allelic variations in this gene are associated with heparin cofactor II deficiency. [provided by RefSeq, Jul 2015]'
• Locus ID: 3053