Mortality Factor 4 like 2 (MORF4L2) (NM_001142422) Human 3' UTR Clone

CAT#: SC208799

3`UTR clone of mortality factor 4 like 2 (MORF4L2) transcript variant 6 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "MORF4L2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol MORF4L2
Synonyms MORFL2; MRGX
ACCN NM_001142422
Insert Size 676
Sequence Data
>SC208799 3'UTR clone of NM_001142422
The sequence shown below is from the reference sequence of NM_001142422. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAAAGTGGCTTCTGCTGAGTACCACCGCAAAGCCCTGTGAGCGTCTACAGACAGCTCACCATTTTTGTCC
TGTATCTGTAAACACTTTTTGTTCTTAGTCTTTTTCTTGTAAAATTGATGTTCTTTAAAATCGTTAATGT
ATAACAGGGCTTATGTTTCAGTTTGTTTTCCGTTCTGTTTTAAACAGAAAATAAAAGGAGTGTAAGCTCC
TTTTCTCATTTCAAAGTTGCTACCAGTGTATGCAGTAATTAGAACAAAGAAGAAACATTCAGTAGAACAT
TTTATTGCCTAGTTGACAACATTGCTTGAATGCTGGTGGTTCCTATCCCTTTGACACTACACAATTTTCT
AATATGTGTTAATGCTATGTGACAAAACGCCCTGATTCCTAGTGCCAAAGGTTCAACTTAATGTATATAC
CTGAAAACCCATGCATTTGTGCTCTTTTTTTTTTTTTATGGTGCTTGAAGTAAAACAGCCCATCCTCTGC
AAGTCCATCTATGTTGTTCTTAGGCATTCTATCTTTGCTCAAATTGTTGAAGGATGGTGATTTGTTTCAT
GGTTTTTGTATTTGAGTCTAATGCACGTTCTAACATGATAGAGGCAATGCATTATTGTGTAGCCACGGTT
TTCTGGAAAAGTTGATATTTTAGGAATTGTATTTCAGATCTTAAAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001142422.1
Summary Component of the NuA4 histone acetyltransferase complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histone H4 and H2A. This modification may both alter nucleosome - DNA interactions and promote interaction of the modified histones with other proteins which positively regulate transcription. This complex may be required for the activation of transcriptional programs associated with oncogene and proto-oncogene mediated growth induction, tumor suppressor mediated growth arrest and replicative senescence, apoptosis, and DNA repair. The NuA4 complex ATPase and helicase activities seem to be, at least in part, contributed by the association of RUVBL1 and RUVBL2 with EP400. NuA4 may also play a direct role in DNA repair when directly recruited to sites of DNA damage. Also component of the MSIN3A complex which acts to repress transcription by deacetylation of nucleosomal histones. [UniProtKB/Swiss-Prot Function]
Locus ID 9643

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.