RGS3 (NM_017790) Human 3' UTR Clone

CAT#: SC208846

3`UTR clone of regulator of G-protein signaling 3 (RGS3) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RGS3
• Synonyms: C2PA; RGP3
• ACCN: NM_017790
• Insert Size: 697 bp
• Sequence Data:
  Insert Sequence

  >SC208846 3'UTR clone of NM_017790
  The sequence shown below is from the reference sequence of NM_017790. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCTTTACCTCACCAGGACAGACTCTGATTGGCTGAGCAAACCCAAGGGCGGGACTCTGCTTCTGGCAACT
  TAACCCTTTCTTGGGCATCCCCTACCACACAGTAACCTCACCTCAACTGGACCTGAAACAGAGGACCAAG
  ATGGTGGGTCTAGGGTCATCTGAAGGGAGTGGTCCCAAGGGTGCATGTGGATGTCAACAGAAGGACCACA
  ATGGTGTGAGAGGCCTTGTGGGCATGCAGAGACTGGCAGCAGAAAGTCCCAAGAGGAGAGGACTCAGAGG
  CTTCTTCCTTCCAAGGAGGAGGAGGAGGAGGACATTCCACATCTGGGCTTCCAGTGGTGGCTCCCGGACC
  TGCCTTGGGGGCAGCAGGAGAGGTTGGGAGAGGTCACCCTGATGAAGAACAATGCCATGATCTGCTGCTG
  CCAGAGGACATCTCCGCCCATCCACTCATTTTCCACCTGTACACATTGGCTCATTCATTCGATGGATATT
  TCGGGTGCATCTACTTTATGCCAGGCTCTATGCTAGGAGCTGGGGATACTGTGGAGAAAAAGTCGGATAT
  GGTCTCGCTCTCATCAAGATTTCAGTCTAGCTGGGAGTGAGCGTTAAATAAGTCAATACCAACACACACA
  CGTGCACACACGTGATGGCAAGCTGTGATCATCTATGAAAGAAAAAACACAGATTTCTTTAAGAGGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_017790.3
• Summary: 'This gene encodes a member of the regulator of G-protein signaling (RGS) family. This protein is a GTPase-activating protein that inhibits G-protein-mediated signal transduction. Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding different isoforms. Long isoforms are largely cytosolic and plasma membrane-associated with a function in Wnt signaling and in the epithelial mesenchymal transition, while shorter N-terminally-truncated isoforms can be nuclear. [provided by RefSeq, Jan 2013]'
• Locus ID: 5998