GRO alpha (CXCL1) (NM_001511) Human 3' UTR Clone

CAT#: SC209215

3`UTR clone of chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity alpha) (CXCL1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CXCL1
• Synonyms: FSP; GRO1; GROa; MGSA; MGSA-a; NAP-3; SCYB1
• ACCN: NM_001511
• Insert Size: 713 bp
• Sequence Data:
  Insert Sequence

  >SC209215 3'UTR clone of NM_001511
  The sequence shown below is from the reference sequence of NM_001511. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGAAAAGATGCTGAACAGTGACAAATCCAACTGACCAGAAGGGAGGAGGAAGCTCACTGGTGGCTGTTCC
  TGAAGGAGGCCCTGCCCTTATAGGAACAGAAGAGGAAAGAGAGACACAGCTGCAGAGGCCACCTGGATTG
  TGCCTAATGTGTTTGAGCATCGCTTAGGAGAAGTCTTCTATTTATTTATTTATTCATTAGTTTTGAAGAT
  TCTATGTTAATATTTTAGGTGTAAAATAATTAAGGGTATGATTAACTCTACCTGCACACTGTCCTATTAT
  ATTCATTCTTTTTGAAATGTCAACCCCAAGTTAGTTCAATCTGGATTCATATTTAATTTGAAGGTAGAAT
  GTTTTCAAATGTTCTCCAGTCATTATGTTAATATTTCTGAGGAGCCTGCAACATGCCAGCCACTGTGATA
  GAGGCTGGCGGATCCAAGCAAATGGCCAATGAGATCATTGTGAAGGCAGGGGAATGTATGTGCACATCTG
  TTTTGTAACTGTTTAGATGAATGTCAGTTGTTATTTATTGAAATGATTTCACAGTGTGTGGTCAACATTT
  CTCATGTTGAAACTTTAAGAACTAAAATGTTCTAAATATCCCTTGGACATTTTATGTCTTTCTTGTAAGG
  CATACTGCCTTGTTTAATGGTAGTTTTACAGTGTTTCTGGCTTAGAACAAAGGGGCTTAATTATTGATGT
  TTTCATAGAGAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001511.2
• Summary: 'This antimicrobial gene encodes a member of the CXC subfamily of chemokines. The encoded protein is a secreted growth factor that signals through the G-protein coupled receptor, CXC receptor 2. This protein plays a role in inflammation and as a chemoattractant for neutrophils. Aberrant expression of this protein is associated with the growth and progression of certain tumors. A naturally occurring processed form of this protein has increased chemotactic activity. Alternate splicing results in coding and non-coding variants of this gene. A pseudogene of this gene is found on chromosome 4. [provided by RefSeq, Sep 2014]'
• Locus ID: 2919