VPS4A (NM_013245) Human 3' UTR Clone

CAT#: SC209710

3`UTR clone of vacuolar protein sorting 4 homolog A (S. cerevisiae) (VPS4A) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: VPS4A
• Synonyms: SKD1; SKD1A; SKD2; VPS4; VPS4-1
• ACCN: NM_013245
• Insert Size: 737
• Sequence Data:
  Insert Sequence

  >SC209710 3'UTR clone of NM_013245
  The sequence shown below is from the reference sequence of NM_013245. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTCTCAGAGGACTTTGGGCAAGAGAGTTAAAAGCTGCTTCACTTGGGCAATGGTGAAGGTGGGAGGTTGA
  TTGGGGCAAATCCAGGCACTCCCCATGTCAACAGCCAGACAGGGCTCCAGGGCTTGTCCCAGTCAATACA
  GAGTTCCCTCTGCTGTCTGGCCGTCTGCCAGGGAGCCAGAAGGAAGGGCCTTGCAGCCACAGAGACACTC
  CACTGCCCTGGGGCACACAGTGGACACTGCTCTTCCTACTTCCTCCTCTCCTGGATGCTCATCAGCTCCT
  TCTGCCTCCCCCCCTTTTTTTTCCATCTTTTGTTCCCCTAAATTAATGCTGCTTGGATTTTCATCTTATT
  TATAAAGATAAAATCACCTGGAAGTGTCAAGGAGTGGGGCGGGGTGGCGGGGGAGAAGCAGCCGTGCTGC
  CAGGTCACCCAGACCTCCAGACAGCCGGCTAGCCCCACTGCCCGTTCCTTTTACGCCCAAGTTTTGCTCC
  TTGAGAGCAGATTGGCTGATGCCCCTGCAACCCCAGCCCAAGCTCTGCCTCAAAGACCGAGTGACATAAG
  CCATTCCCACCCTCCTAGGTTCACATCCAGGGCTGTGTCTTCCTTGGGGGAGGAGATGGTGTCGTTTAGA
  TCAGGGTAAGGCAGTCAGGCGGGTGTTCACCACTGCCTTTTCTTCCTCTGAGCGTGAGAACACTGAACCC
  AGCCACTGCCCCTGGGTCCCTGTCCTGGAAATGGTCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_013245.2
• Summary: The protein encoded by this gene is a member of the AAA protein family (ATPases associated with diverse cellular activities), and is the homolog of the yeast Vps4 protein. In humans, two paralogs of the yeast protein have been identified. The former share a high degree of aa sequence similarity with each other, and also with yeast Vps4 and mouse Skd1 proteins. The mouse Skd1 (suppressor of K+ transport defect 1) has been shown to be really an yeast Vps4 ortholog. Functional studies indicate that both human paralogs associate with the endosomal compartments, and are involved in intracellular protein trafficking, similar to Vps4 protein in yeast. The gene encoding this paralog has been mapped to chromosome 16; the gene for the other resides on chromosome 18. [provided by RefSeq, Jul 2008]
• Locus ID: 27183