Aurora A (AURKA) (NM_003600) Human 3' UTR Clone

CAT#: SC209768

3`UTR clone of aurora kinase A (AURKA) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "AURKA"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol AURKA
Synonyms AIK; ARK1; AURA; BTAK; PPP1R47; STK6; STK7; STK15
ACCN NM_003600
Insert Size 806 bp
Sequence Data
>SC209768 3'UTR clone of NM_003600
The sequence shown below is from the reference sequence of NM_003600. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TTGCCAAAACAAAGAATCAGCTAGCAAACAGTCTTAGGAATCGTGCAGGGGGAGAAATCCTTGAGCCAGG
GCTGCCATATAACCTGACAGGAACATGCTACTGAAGTTTATTTTACCATTGACTGCTGCCCTCAATCTAG
AACGCTACACAAGAAATATTTGTTTTACTCAGCAGGTGTGCCTTAACCTCCCTATTCAGAAAGCTCCACA
TCAATAAACATGACACTCTGAAGTGAAAGTAGCCACGAGAATTGTGCTACTTATACTGGTTCATAATCTG
GAGGCAAGGTTCGACTGCAGCCGCCCCGTCAGCCTGTGCTAGGCATGGTGTCTTCACAGGAGGCAAATCC
AGAGCCTGGCTGTGGGGAAAGTGACCACTCTGCCCTGACCCCGATCAGTTAAGGAGCTGTGCAATAACCT
TCCTAGTACCTGAGTGAGTGTGTAACTTATTGGGTTGGCGAAGCCTGGTAAAGCTGTTGGAATGAGTATG
TGATTCTTTTTAAGTATGAAAATAAAGATATATGTACAGACTTGTATTTTTTCTCTGGTGGCATTCCTTT
AGGAATGCTGTGTGTCTGTCCGGCACCCCGGTAGGCCTGATTGGGTTTCTAGTCCTCCTTAACCACTTAT
CTCCCATATGAGAGTGTGAAAAATAGGAACACGTGCTCTACCTCCATTTAGGGATTTGCTTGGGATACAG
AAGAGGCCATGTGTCTCAGAGCTGTTAAGGGCTTATTTTTTTAAAACATTGGAGTCATAGCATGTGTGTA
AACTTTAAATATGCAAATAAATAAGTATCTATGTCT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_003600.2
Summary 'The protein encoded by this gene is a cell cycle-regulated kinase that appears to be involved in microtubule formation and/or stabilization at the spindle pole during chromosome segregation. The encoded protein is found at the centrosome in interphase cells and at the spindle poles in mitosis. This gene may play a role in tumor development and progression. A processed pseudogene of this gene has been found on chromosome 1, and an unprocessed pseudogene has been found on chromosome 10. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]'
Locus ID 6790

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.