E2F4 (NM_001950) Human 3' UTR Clone

CAT#: SC209960

3`UTR clone of E2F transcription factor 4 p107/p130-binding (E2F4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: E2F4
• Synonyms: E2F-4
• ACCN: NM_001950
• Insert Size: 827 bp
• Sequence Data:
  Insert Sequence

  >SC209960 3'UTR clone of NM_001950
  The sequence shown below is from the reference sequence of NM_001950. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTGACCTCTTTGATGTGCCTGTTCTCAACCTCTGACTGACAGGGACATGCCCTGTGTGGCTGGGACCCAG
  ACTGTCTGACCTGGGGGTTGCCTGGGGACCTCTCCCACCCGACCCCTACAGAGCTTGAGAGCCACAGACG
  CCTGGCTTCTCCGGCCTCCCCTCACCGCACAGTTCTGGCCACAGCTCCCGCTCCTGTGCTGGCACTTCTG
  TGCTCGCAGAGCAGGGGAACAGGACTCAGCCCCCATCACCGTGGAGCCAAAGTGTTTGCTTCTCCCTTTC
  TGCGGCCTTCGCCAGCCCAGGCTCGGCTGCCACCCAGTGGCACAGAACCGAGGAGCTGCCATTACCCCCC
  ATAGGGGGCAGTGTCTTGTTCCTGCCAGCCTCAGTGTCTTGCTTCTGCCAGCTCCTTCCCCTAGGAGGGA
  AGGGTGGGGTGGAACTGGGCACATGCCAGCACCACTTCTAGCTTCCTTCGCTATCCCCCACCCCCTGACC
  CTCCAGCTCCTCCTGGCCCTCTCACGTGCCCACTTCTGCTGGGCCTTTAGCCCTAGAACCTGCAGGTGGT
  GGGGGCGGCTACCAAGAAGGAACAGAGGTCTCTGGGGAGGAGTCTGGGTGGTCCAGCCCTGATGATTGGC
  CCCACCTCCTGCTGCCCCATAACCCTCTCTTCATTTCGGCTTTTTCATTTACCCTCATTTAGAGCCATTT
  GCAGAGATTTAGAAAGATTTACAGTAACGAATGGATTCCTATATAAAGATTATTTTTATACTTTTTGCAG
  CAAAAGGAAATTGTAATATTTGTACAGTGTTCAAGTGAATAAAAACCATGCCTAAGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001950.3
• Summary: 'The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein binds to all three of the tumor suppressor proteins pRB, p107 and p130, but with higher affinity to the last two. It plays an important role in the suppression of proliferation-associated genes, and its gene mutation and increased expression may be associated with human cancer. [provided by RefSeq, Jul 2008]'
• Locus ID: 1874