PBP (PEBP1) (NM_002567) Human 3' UTR Clone

CAT#: SC209990

3`UTR clone of phosphatidylethanolamine binding protein 1 (PEBP1) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PEBP1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PEBP1
Synonyms HCNP; HCNPpp; HEL-210; HEL-S-34; HEL-S-96; PBP; PEBP; PEBP-1; RKIP
ACCN NM_002567
Insert Size 794 bp
Sequence Data
>SC209990 3'UTR clone of NM_002567
The sequence shown below is from the reference sequence of NM_002567. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGTGCCCAAACTGTACGAGCAGCTGTCTGGGAAGTAGGGGGTTAGCTTGGGGACCTGAACTGTCCTGGAG
GCCCCAAGCCATGTTCCCCAGTTCAGTGTTGCATGTATAATAGATTTCTCCTCTTCCTGCCCCCCTTGGC
ATGGGTGAGACCTGACCAGTCAGATGGTAGTTGAGGGTGACTTTTCCTGCTGCCTGGCCTTTATAATTTT
ACTCACTCACTCTGATTTATGTTTTGATCAAATTTGAACTTCATTTTGGGGGGTATTTTGGTACTGTGAT
GGGGTCATCAAATTATTAATCTGAAAATAGCAACCCAGAATGTAAAAAAGAAAAAACTGGGGGGAAAAAG
ACCAGGTCTACAGTGATAGAGCAAAGCATCAAAGAATCTTTAAGGGAGGTTTAAAAAAAAAAAAAAAAAA
AAAGATTGGTTGCCTCTGCCTTTGTGATCCTGAGTCCAGAATGGTACACAATGTGATTTTATGGTGATGT
CACTCACCTAGACAACCAGAGGCTGGCATTGAGGCTAACCTCCAACACAGTGCATCTCAGATGCCTCAGT
AGGCATCAGTATGTCACTCTGGTCCCTTTAAAGAGCAATCCTGGAAGAAGCAGGAGGGAGGGTGGCTTTG
CTGTTGTTGGGACATGGCAATCTAGACCGGTAGCAGCGCTCGCTGACAGCTTGGGAGGAAACCTGAGATC
TGTGTTTTTTAAATTGATCGTTCTTCATGGGGGTAAGAAAAGCTGGTCTGGAGTTGCTGAATGTTGCATT
AATTGTGCTGTTTGCTTGTAGTTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_002567.2
Summary 'This gene encodes a member of the phosphatidylethanolamine-binding family of proteins and has been shown to modulate multiple signaling pathways, including the MAP kinase (MAPK), NF-kappa B, and glycogen synthase kinase-3 (GSK-3) signaling pathways. The encoded protein can be further processed to form a smaller cleavage product, hippocampal cholinergic neurostimulating peptide (HCNP), which may be involved in neural development. This gene has been implicated in numerous human cancers and may act as a metastasis suppressor gene. Multiple pseudogenes of this gene have been identified in the genome. [provided by RefSeq, Jul 2015]'
Locus ID 5037

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.