beta Catenin (CTNNB1) (NM_001098209) Human 3' UTR Clone

CAT#: SC210020

3`UTR clone of catenin (cadherin-associated protein) beta 1 88kDa (CTNNB1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CTNNB1
• Synonyms: armadillo; CTNNB; EVR7; MRD19; NEDSDV
• ACCN: NM_001098209
• Insert Size: 798 bp
• Sequence Data:
  Insert Sequence

  >SC210020 3'UTR clone of NM_001098209
  The sequence shown below is from the reference sequence of NM_001098209. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTGGTTTGATACTGACCTGTAAATCATCCTTTAGCTGTATTGTCTGAACTTGCATTGTGATTGGCCTGT
  AGAGTTGCTGAGAGGGCTCGAGGGGTGGGCTGGTATCTCAGAAAGTGCCTGACACACTAACCAAGCTGAG
  TTTCCTATGGGAACAATTGAAGTAAACTTTTTGTTCTGGTCCTTTTTGGTCGAGGAGTAACAATACAAAT
  GGATTTTGGGAGTGACTCAAGAAGTGAAGAATGCACAAGAATGGATCACAAGATGGAATTTATCAAACCC
  TAGCCTTGCTTGTTAAATTTTTTTTTTTTTTTTTTTAAGAATATCTGTAATGGTACTGACTTTGCTTGCT
  TTGAAGTAGCTCTTTTTTTTTTTTTTTTTTTTTTTTTGCAGTAACTGTTTTTTAAGTCTCTCGTAGTGTT
  AAGTTATAGTGAATACTGCTACAGCAATTTCTAATTTTTAAGAATTGAGTAATGGTGTAGAACACTAATT
  CATAATCACTCTAATTAATTGTAATCTGAATAAAGTGTAACAATTGTGTAGCCTTTTTGTATAAAATAGA
  CAAATAGAAAATGGTCCAATTAGTTTCCTTTTTAATATGCTTAAAATAAGCAGGTGGATCTATTTCATGT
  TTTTGATCAAAAACTATTTGGGATATGTATGGGTAGGGTAAATCAGTAAGAGGTGTTATTTGGAACCTTG
  TTTTGGACAGTTTACCAGTTGCCTTTTATCCCAAAGTTGTTGTAACCTGCTGTGATACGATGCTTCAAGA
  GAAAATGCGGTTATAAAAAATGGTTCAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001098209.1
• Summary: 'The protein encoded by this gene is part of a complex of proteins that constitute adherens junctions (AJs). AJs are necessary for the creation and maintenance of epithelial cell layers by regulating cell growth and adhesion between cells. The encoded protein also anchors the actin cytoskeleton and may be responsible for transmitting the contact inhibition signal that causes cells to stop dividing once the epithelial sheet is complete. Finally, this protein binds to the product of the APC gene, which is mutated in adenomatous polyposis of the colon. Mutations in this gene are a cause of colorectal cancer (CRC), pilomatrixoma (PTR), medulloblastoma (MDB), and ovarian cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]'
• Locus ID: 1499