Decorin (DCN) (NM_133505) Human 3' UTR Clone

CAT#: SC210137

3`UTR clone of decorin (DCN) transcript variant C for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol DCN
Synonyms CSCD; DSPG2; PG40; PGII; PGS2; SLRR1B
ACCN NM_133505
Insert Size 807 bp
Sequence Data
>SC210137 3'UTR clone of NM_133505
The sequence shown below is from the reference sequence of NM_133505. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTCTGCCATTCAACTCGGAAACTATAAGTAATTCTCAAGAAAGCCCTCATTTTTATAACCTGGCAAAATC
TTGTTAATGTCATTGCTAAAAAATAAATAAAAGCTAGATACTGGAAACCTAACTGCAATGTGGATGTTTT
ACCCACATGACTTATTATGCATAAAGCCAAATTTCCAGTTTAAGTAATTGCCTACAATAAAAAGAAATTT
TGCCTGCCATTTTCAGAATCATCTTTTGAAGCTTTCTGTTGATGTTAACTGAGCTACTAGAGATATTCTT
ATTTCACTAAATGTAAAATTTGGAGTAAATATATATGTCAATATTTAGTAAAGCTTTTCTTTTTTAATTT
CCAGGAAAAAATAAAAAGAGTATGAGTCTTCTGTAATTCATTGAGCAGTTAGCTCATTTGAGATAAAGTC
AAATGCCAAACACTAGCTCTGTATTAATCCCCATCATTACTGGTAAAGCCTCATTTGAATGTGTGAATTC
AATACAGGCTATGTAAAATTTTTACTAATGTCATTATTTTGAAAAAATAAATTTAAAAATACATTCAAAA
TTACTATTGTATACAAGCTTAATTGTTAATATTCCCTAAACACAATTTTATGAAGGGAGAAGACATTGGT
TTGTTGACAATAACAGTACATCTTTTCAAGTTCTCAGCTATTTCTTCTACCTCTCCCTATCTTACATTTG
AGTATGGTAACTTATGTCATCTATGTTGAATGTAAGCTTATAAAGCACAAAGCATACATTTCCTGACTGG
TCTAGAGAACTGATGTTTCAATTTACCCCTCTGCTAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_133505.2
Summary 'This gene encodes a member of the small leucine-rich proteoglycan family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protein. This protein plays a role in collagen fibril assembly. Binding of this protein to multiple cell surface receptors mediates its role in tumor suppression, including a stimulatory effect on autophagy and inflammation and an inhibitory effect on angiogenesis and tumorigenesis. This gene and the related gene biglycan are thought to be the result of a gene duplication. Mutations in this gene are associated with congenital stromal corneal dystrophy in human patients. [provided by RefSeq, Nov 2015]'
Locus ID 1634

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.