Decorin (DCN) (NM_001920) Human 3' UTR Clone

CAT#: SC210140

3`UTR clone of decorin (DCN) transcript variant A1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DCN
• Synonyms: CSCD; DSPG2; PG40; PGII; PGS2; SLRR1B
• ACCN: NM_001920
• Insert Size: 807 bp
• Sequence Data:
  Insert Sequence

  >SC210140 3'UTR clone of NM_001920
  The sequence shown below is from the reference sequence of NM_001920. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTCTGCCATTCAACTCGGAAACTATAAGTAATTCTCAAGAAAGCCCTCATTTTTATAACCTGGCAAAATC
  TTGTTAATGTCATTGCTAAAAAATAAATAAAAGCTAGATACTGGAAACCTAACTGCAATGTGGATGTTTT
  ACCCACATGACTTATTATGCATAAAGCCAAATTTCCAGTTTAAGTAATTGCCTACAATAAAAAGAAATTT
  TGCCTGCCATTTTCAGAATCATCTTTTGAAGCTTTCTGTTGATGTTAACTGAGCTACTAGAGATATTCTT
  ATTTCACTAAATGTAAAATTTGGAGTAAATATATATGTCAATATTTAGTAAAGCTTTTCTTTTTTAATTT
  CCAGGAAAAAATAAAAAGAGTATGAGTCTTCTGTAATTCATTGAGCAGTTAGCTCATTTGAGATAAAGTC
  AAATGCCAAACACTAGCTCTGTATTAATCCCCATCATTACTGGTAAAGCCTCATTTGAATGTGTGAATTC
  AATACAGGCTATGTAAAATTTTTACTAATGTCATTATTTTGAAAAAATAAATTTAAAAATACATTCAAAA
  TTACTATTGTATACAAGCTTAATTGTTAATATTCCCTAAACACAATTTTATGAAGGGAGAAGACATTGGT
  TTGTTGACAATAACAGTACATCTTTTCAAGTTCTCAGCTATTTCTTCTACCTCTCCCTATCTTACATTTG
  AGTATGGTAACTTATGTCATCTATGTTGAATGTAAGCTTATAAAGCACAAAGCATACATTTCCTGACTGG
  TCTAGAGAACTGATGTTTCAATTTACCCCTCTGCTAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001920.3
• Summary: 'This gene encodes a member of the small leucine-rich proteoglycan family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protein. This protein plays a role in collagen fibril assembly. Binding of this protein to multiple cell surface receptors mediates its role in tumor suppression, including a stimulatory effect on autophagy and inflammation and an inhibitory effect on angiogenesis and tumorigenesis. This gene and the related gene biglycan are thought to be the result of a gene duplication. Mutations in this gene are associated with congenital stromal corneal dystrophy in human patients. [provided by RefSeq, Nov 2015]'
• Locus ID: 1634