FUBP1 (NM_003902) Human 3' UTR Clone

CAT#: SC210545

3`UTR clone of far upstream element (FUSE) binding protein 1 (FUBP1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: FUBP1
• Synonyms: FBP; FUBP; hDH V
• ACCN: NM_003902
• Insert Size: 886
• Sequence Data:
  Insert Sequence

  >SC210545 3'UTR clone of NM_003902
  The sequence shown below is from the reference sequence of NM_003902. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AATGCCACAGCATCCTCCAGCACCTCAGGGCCAATAATAAGAAGTGGACAATACAGTATTTGCTTCATTG
  TGTGGGGGAAAAAAACCTTTGTTAAATATATGGATGCAGACGACTTGATGAAGATCTTAATTTTGTTTTT
  GGTTTAAAATAGTGTTTCCTTTTTTTTTTTTTTTTTTGAAAATGTACAAAATATCTATCACTACTGATAG
  GAGGTTAATATTTCTGTGTAGAAATGAAAATTGGTTTGTTTTTAGTATTTAGTGTAGATGTACACATTCC
  AGCAAATGTATTTGCAATTATGTGGTTGATGCTTTGTGATATAAATGTACTTTTTCAATGTATACTTTCA
  CTTTTAAAATGCCTGTTTTGTGCTTTACAATAAATGATATGAAACCTCCTGTGTCGGTAAGTTGGATATG
  TGGGTATTTAAAGGATTCATAATTTCTTAGCAATGATAAATTAAGATACATATACACAAATATATAAGCT
  TTCCCCATGAAATATTGAGTTTTTAAACACTGGCATGTTTTTCCCCCCTTGCAGTATAGTGGTAGATTGG
  AGGATCTTTTCCATTTATTGTATTGGCTCTTTCAGCACAAGTAATCCTGATATCTTCATTTTTTTTCCTT
  CTGTTTGATTAAAAACTGCATGTGTGTACAATGATCTTTTGGCATACTTCCATTGCATTAACAGTGAAAT
  TTCCTTTTATACATGACCACTGTTTCAGACCTGTACTGCTGCTATAACAGTTAACCTTTCTGTTCTTAAT
  TTGATAATACTTGATTTCCAAGACTGTTTCGGCATAACTAATTTTAAACAGTTTTCAGATAGTGAATATG
  AGTAGTCTAATAAGAACAGTTTTTTTCCATGTGAAGCAACTCTTTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003902.3
• Summary: The protein encoded by this gene is a single stranded DNA-binding protein that binds to multiple DNA elements, including the far upstream element (FUSE) located upstream of c-myc. Binding to FUSE occurs on the non-coding strand, and is important to the regulation of c-myc in undifferentiated cells. This protein contains three domains, an amphipathic helix N-terminal domain, a DNA-binding central domain, and a C-terminal transactivation domain that contains three tyrosine-rich motifs. The N-terminal domain is thought to repress the activity of the C-terminal domain. This protein is also thought to bind RNA, and contains 3'-5' helicase activity with in vitro activity on both DNA-DNA and RNA-RNA duplexes. Aberrant expression of this gene has been found in malignant tissues, and this gene is important to neural system and lung development. Binding of this protein to viral RNA is thought to play a role in several viral diseases, including hepatitis C and hand, foot and mouth disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
• Locus ID: 8880