Fabp5 (BC002008) Mouse Untagged Clone

CAT#: MC200066

Fabp5 (untagged) - Mouse fatty acid binding protein 5, epidermal (cDNA clone MGC:5786 IMAGE:3490535), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Fabp5
• Synonyms: mal1
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC002008
  CGCGTCTCTGCTGCTTTTGTGCTCTCCCTCCCGCCATGGCCAGCCTTAAGGATCTCGAAGGGAAGTGGCG CCTGATGGAAAGCCACGGCTTTGAGGAGTACATGAAAGAGCTAGGAGTAGGACTGGCTCTTAGGAAGATG GCTGCCATGGCCAAGCCAGACTGTATCATTACGTGTGATGGCAACAACATCACGGTCAAAACCGAGAGCA CAGTGAAGACGACCGTGTTCTCTTGTAACCTGGGAGAGAAGTTTGATGAAACGACAGCTGATGGCAGAAA AACTGAGACGGTCTGCACCTTCCAAGACGGTGCCCTGGTCCAGCACCAGCAATGGGACGGGAAGGAGAGC ACGATAACAAGAAAACTGAAGGATGGGAAGATGATCGTGGAGTGTGTCATGAACAATGCCACCTGCACTC GGGTCTATGAGAAGGTGCAATGAGGGCTTCCTCGTCATCCTGGACAGGAGTTAGCTGCCAGAGTGAATAT GCTCAATTCAGTGAGCGGTCAAATGCAACAAACAGCTTCACTTCTTTGGTTTTATTTTTCATGACTGTTG AGTTCTCTTTATCACAAACACTTTACATGGACCTTCATGTCAAACTTGGTTTACCCAGGATCATTCCTTT GGTTAGTAAATAAACGTGTTAGTGCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: BC002008
• ORF Size: 408 bp
• Insert Size: 408
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: BC002008, AAH02008
• RefSeq Size: 713
• RefSeq ORF: 408
• Locus ID: 16592
• Gene Summary: The protein encoded by this gene is part of the fatty acid binding protein family (FABP). FABPs are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands and participate in fatty acid uptake, transport, and metabolism. In humans this gene has been associated with psoriasis and type 2 diabetes. In mouse deficiency of this gene in combination with a deficiency in Fabp4 confers protection against atherosclerosis, diet-induced obesity, insulin resistance and experimental autoimmune encephalomyelitis (the mouse model for multiple sclerosis). Alternative splicing results in multiple transcript variants that encode different protein isoforms. The mouse genome contains many pseudogenes similar to this locus. [provided by RefSeq, Jan 2013]