Cox7a2 (NM_009945) Mouse Untagged Clone

CAT#: MC200850

Cox7a2 (untagged) - Mouse cytochrome c oxidase, subunit VIIa 2 (Cox7a2), nuclear gene encoding mitochondrial protein, (10ug)


  "NM_009945" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Cox7a2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cox7a2
Synonyms Cox7a3; COX7AL; CoxVIIa-L
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC010979 sequence for NM_009945
CCCGCGTCCGGTCGCGGTTGGTGGGTAACAACCGAGCCAAGATGTTGCGGAATCTGCTGGCCCTTCGTCA GATTGCCCAGAGGACCATCAGCACCACTTCACGAAGGCATTTTGAAAACAAGGTTCCAGAGAAACAAAAG CTGTTTCAGGAGGATAATGGGATGCCAGTTCATCTGAAAGGCGGGGCATCTGATGCCCTCCTCTACAGAG CCACAATGGCTCTGACGCTTGGTGGCACAGCCTATGCCATCTATCTGTTAGCTATGGCTGCATTTCCCAA GAAGCAGAACTAATGTCGTCATCCCAGTCTTCACGTGGTTCAGTTTCATCAACGCTCGATGGACCAGGAA TCTGATGAGTAACTGAGCTCTTCTTTGGGGATCAATATTTATTGATGTGTATTAACTGCTGCCAATAAAG CAATCCTTAACCAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_009945
ORF Size 252 bp
Insert Size 252
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC010979, AAH10979
RefSeq Size 451
RefSeq ORF 252
Locus ID 12866
Gene Summary This protein is one of the nuclear-coded polypeptide chains of cytochrome c oxidase, the terminal oxidase in mitochondrial electron transport. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.