Rps21 (NM_025587) Mouse Untagged Clone

CAT#: MC201413

Rps21 (untagged) - Mouse ribosomal protein S21 (Rps21), (10ug)


  "NM_025587" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Rps21"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rps21
Synonyms 1810049N11Rik; 2410030A14Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC027563 sequence for NM_025587
GCTGGACAAGTGAGCAGGGACGGCCTCAGGATGCAGAACGACGCCGGCGAGTTTGTGGACCTGTACGTGC CGCGGAAATGCTCCGCAAGCAACCGCATCATTGCTGCCAAGGACCACGCGTCCATCCAGATGAACGTGGC CGAGGTTGATAGGACCACAGGCCGGTTTAATGGCCAGTTTAAAACCTATGGCATCTGCGGGGCCATTCGC AGGATGGGCGAGTCAGATGATTCTATTCTCCGATTGGCTAAGGCTGATGGAATTGTCTCAAAGAACTTTT GAGCAGAAGAAATCGGGAATTTGTTACAAATAAAAGTTTTAAGTACCTGTGAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
ACCN NM_025587
ORF Size 252 bp
Insert Size 252
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC027563, AAH27563
RefSeq Size 349
RefSeq ORF 252
Locus ID 66481

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.