Mt2 (NM_008630) Mouse Untagged Clone

CAT#: MC201431

Mt2 (untagged) - Mouse metallothionein 2 (Mt2), (10ug)


  "NM_008630" in other vectors (6)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Mt2
Synonyms AA409533; Mt-2; MT-II
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC031758 sequence for NM_008630
CTTCAAACCGATCTCTCGTCGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGC CTCCGATGGATCCTGCTCCTGTGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAA AGCTGCTGCTCCTGCTGCCCCGTGGGCTGTGCGAAGTGCTCCCAGGGCTGCATCTGCAAAGAGGCTTCCG ACAAGTGCAGCTGCTGTGCCTGAAGGGGGGCGGAGGGGTCCCCACATCTGTGTAAATAGACCATGTAGAA GCCTAGCCTTTTTTGTACAACCCTGACCCGTTCTCCACAACTTTTTCTATAAAGCATGTAACTGACAATA AAAGCCGTTGACTTAATTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_008630
ORF Size 186 bp
Insert Size 186
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC031758, AAH31758
RefSeq Size 411
RefSeq ORF 186
Locus ID 17750
Gene Summary Metallothioneins have a high content of cysteine residues that bind various heavy metals; these proteins are transcriptionally regulated by both heavy metals and glucocorticoids. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.