Mt2 (NM_008630) Mouse Untagged Clone
CAT#: MC201431
Mt2 (untagged) - Mouse metallothionein 2 (Mt2), (10ug)
"NM_008630" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Mt2 |
Synonyms | AA409533; Mt-2; MT-II |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC031758 sequence for NM_008630
CTTCAAACCGATCTCTCGTCGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGC CTCCGATGGATCCTGCTCCTGTGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAA AGCTGCTGCTCCTGCTGCCCCGTGGGCTGTGCGAAGTGCTCCCAGGGCTGCATCTGCAAAGAGGCTTCCG ACAAGTGCAGCTGCTGTGCCTGAAGGGGGGCGGAGGGGTCCCCACATCTGTGTAAATAGACCATGTAGAA GCCTAGCCTTTTTTGTACAACCCTGACCCGTTCTCCACAACTTTTTCTATAAAGCATGTAACTGACAATA AAAGCCGTTGACTTAATTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_008630 |
ORF Size | 186 bp |
Insert Size | 186 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | BC031758, AAH31758 |
RefSeq Size | 411 |
RefSeq ORF | 186 |
Locus ID | 17750 |
Gene Summary | Metallothioneins have a high content of cysteine residues that bind various heavy metals; these proteins are transcriptionally regulated by both heavy metals and glucocorticoids. [UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR200037 | Mt2 (Myc-DDK-tagged) - Mouse metallothionein 2 (Mt2) |
USD 68.00 |
|
MG200037 | Mt2 (GFP-tagged) - Mouse metallothionein 2 (Mt2) |
USD 300.00 |
|
MR200037L1 | Lenti ORF clone of Mt2 (Myc-DDK-tagged) - Mouse metallothionein 2 (Mt2) |
USD 624.00 |
|
MR200037L2 | Lenti ORF clone of Mt2 (mGFP-tagged) - Mouse metallothionein 2 (Mt2) |
USD 500.00 |
|
MR200037L3 | Lenti ORF clone of Mt2 (Myc-DDK-tagged) - Mouse metallothionein 2 (Mt2) |
USD 500.00 |
|
MR200037L4 | Lenti ORF clone of Mt2 (mGFP-tagged) - Mouse metallothionein 2 (Mt2) |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review