Ndufa1 (NM_019443) Mouse Untagged Clone
CAT#: MC201809
Ndufa1 (untagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 (Ndufa1), nuclear gene encoding mitochondrial protein, (10ug)
"NM_019443" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Ndufa1 |
Synonyms | 1810049F12Rik; MWFE |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC024364 sequence for NM_019443
AGCCGGGTCACCTCTGAGGAGCCGGTGACGGGTTGGCGTGCGAGTAACGGTGCGGAGATGTGGTTCGAGA TTCTCCCTGGCCTCGCCATTATGGGGGTGTGCTTGGTCATCCCCGGGGTGTCCACTGCGTACATCCACAA ATTCACCAACGGGGGCAAGGAAAAACGAGTTGCTCGTGTTCAGTACCAGTGGTATCTGATGGAACGCGAT AGACGTATCTCTGGAGTCAATCGCTACTATGTGTCCAAGGGCCTGGAAAACATTGACTAAGGAAGCATTT TCCTGGCTGATTAAAAGAAATTACTCAGCTATGGTCATCTGTTCCTGTTAGAAGGCTATGCAGCATATTA TATACTATGCGCATGTTATGAAATGCATAATAAAAAATTTTAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_019443 |
ORF Size | 213 bp |
Insert Size | 213 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | BC024364, AAH24364 |
RefSeq Size | 406 |
RefSeq ORF | 213 |
Locus ID | 54405 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC201810 | Ndufa1 (untagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 (Ndufa1), nuclear gene encoding mitochondrial protein, (10ug) |
USD 210.00 |
|
MR200077 | Ndufa1 (Myc-DDK-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 (Ndufa1), nuclear gene encoding mitochondrial protein |
USD 68.00 |
|
MG200077 | Ndufa1 (GFP-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 (Ndufa1) |
USD 300.00 |
|
MR200077L3 | Lenti ORF clone of Ndufa1 (Myc-DDK-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 (Ndufa1), nuclear gene encoding mitochondrial protein |
USD 500.00 |
|
MR200077L4 | Lenti ORF clone of Ndufa1 (mGFP-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 (Ndufa1), nuclear gene encoding mitochondrial protein |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review