Ndufa1 (NM_019443) Mouse Untagged Clone

CAT#: MC201810

Ndufa1 (untagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 (Ndufa1), nuclear gene encoding mitochondrial protein, (10ug)


  "NM_019443" in other vectors (5)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Ndufa1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ndufa1
Synonyms 1810049F12Rik; MWFE
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC024364 sequence for NM_019443
AGCCGGGTCACCTCTGAGGAGCCGGTGACGGGTTGGCGTGCGAGTAACGGTGCGGAGATGTGGTTCGAGA TTCTCCCTGGCCTCGCCATTATGGGGGTGTGCTTGGTCATCCCCGGGGTGTCCACTGCGTACATCCACAA ATTCACCAACGGGGGCAAGGAAAAACGAGTTGCTCGTGTTCAGTACCAGTGGTATCTGATGGAACGCGAT AGACGTATCTCTGGAGTCAATCGCTACTATGTGTCCAAGGGCCTGGAAAACATTGACTAAGGAAGCATTT TCCTGGCTGATTAAAAGAAATTACTCAGCTATGGTCATCTGTTCCTGTTAGAAGGCTATGCAGCATATTA TATACTATGCGCATGTTATGAAATGCATAATAAAAAATTTTAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_019443
ORF Size 213 bp
Insert Size 213
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC024364, AAH24364
RefSeq Size 406
RefSeq ORF 213
Locus ID 54405

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.