Rps27l (NM_026467) Mouse Untagged Clone

CAT#: MC202392

Rps27l (untagged) - Mouse ribosomal protein S27-like (Rps27l), (10ug)


  "NM_026467" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Rps27l"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rps27l
Synonyms 1810034D23Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC058115 sequence for NM_026467
CGAAAGCGAGCAGTTCGTCTCGGCGACCTGGAGCGGCCGCGCTTGCGGAGCCGTCACCATGCCCCTGGCT AGAGATCTGTTACACCCTTCCTTGGAGGAGGAGAAGAAAAAACATAAGAAGAAACGGCTGGTTCAGAGCC CAAATTCTTACTTCATGGATGTGAAATGTCCAGGTTGCTACAAGATTACTACAGTTTTCAGCCATGCACA GACTGTGGTTCTTTGTGTGGGTTGTTCAACTGTGTTGTGCCAGCCCACAGGAGGAAAAGCCAGGCTCACA GAAGGCTGTTCATTTAGAAGAAAGCAACACTAATGAGCTATGAAGTTCCGGAATTTGTGTTTTTCACAGA AAGCCTTACCAACTTCAGTTACTTTACCAAGACAATGTAATTATTGTTTGATTTTATAAAGTCTACAACA ATGAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI     
ACCN NM_026467
ORF Size 255 bp
Insert Size 255
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC058115, AAH58115
RefSeq Size 446
RefSeq ORF 255
Locus ID 67941

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.