Tnp1 (NM_009407) Mouse Untagged Clone

CAT#: MC204986

Tnp1 (untagged) - Mouse transition protein 1 (Tnp1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tnp1
• Synonyms: Stp-1; Tp-1; TP1
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC061170
  CAAAGCCCCTCATTTCGGCAGAAAGTACCATGTCGACCAGCCGCAAGCTAAAGACTCATGGCATGAGGAG AGGCAAGAACCGAGCTCCTCACAAGGGCGTCAAGAGAGGTGGAAGCAAGAGAAAATACCGGAAGAGCGTC CTGAAAAGTAGGAAACGGGGCGATGATGCAAGTCGCAATTACCGATCCCACTTGTGATGCGGCAATGAGC TCTGCCCTGGTGGTCTTCAAACAACACGGGGCAGGAGCATGAGGACATCAGAGGGGGACTGCCAAAGAGA TCTGAAGTTAGACCAAAAGCCAAAGATCCTATCAGAGTGGGTAAATGCCAGTCGTGACGAAATTCGGAAT GTATATGTTGGCTGTTTCTCCCCAACATCTCAATAACATTTTGAAAACAAATAAAATTGTGAAAAACAAA AAAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: SfiI-SfiI
• ACCN: NM_009407
• ORF Size: 168 bp
• Insert Size: 168
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC061170, AAH61170
• RefSeq Size: 447
• RefSeq ORF: 168
• Locus ID: 21958
• Gene Summary: In the elongating spermatids of mammals, the conversion of nucleosomal chromatin to the compact, non-nucleosomal form found in the sperm nucleus is associated with the appearance of a small set of basic chromosomal transition proteins. [UniProtKB/Swiss-Prot Function]