Ap4s1 (NM_021710) Mouse Untagged Clone

CAT#: MC205886

Ap4s1 (untagged) - Mouse adaptor-related protein complex AP-4, sigma 1 (Ap4s1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ap4s1
• Synonyms: AI314282
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC053339
  GGACGCCATGCTAAAAGCCAAAATGGCTGCCCCAAGGATGCCCGCAGCGCGCCGCCCGTGAGGAGGGAGC CGGGCGCGCCGTCACCGCTCGCCGGCCGGAGCGGCTCAGGTTCCAGCTACGGTCATCCAGTGCCATAACT TTTAAAGGATATTGCAAAGAAACTGGGAAAGGGTGAAAAAATGATCAAGTTTTTCCTTATGGTGAACAAG CAAGGGCAGACCCGACTGTCTAAGTACTACGAGCATGTGGACATTAATAAACGTGCGCTTCTGGAGACTG AGGTCAGCAAGAGTTGCCTGTCTCGGTCCAGCGAACAATGCTCATTCATTGAATACAAGGATTTTAAACT GATCTACCGGCAATATGCAGCTCTCTTTGTTGTGGTTGGAGTTAATGACACTGAGAATGAGATGGCTATC TATGAATTTATACACAATTTTGTGGAAGTTTTAGATGGGTACTTCAGCCGAGTGAGTGAATTAGATATAA TGTTTAATTTGGATAAAGTTCACATCATTTTGGATGAGATGGTGTTAAATGGCTGCATTGTGGAAACTAA CAGAGCCAGAATTCTTGCCCCTCTGCTGATTCTTGACAAGCTGTCGGAAAGCTGATGAAGACGATCAGGG TTTGAGTGCTGTGAAGGCCAAGGAAGAGATCATGGATGACAGCAGCCTTCTATAGTTCCTATCCCATAGT TCCTAAAGAGAAAACAATTCTTGTGTACACATTTTTCTCTTAACAGAGAGCCACAATTTTACTTGGTAAC TGTAAGCTTGCTTTTCCTTCTATAGGTACTGCAGGGTTGCAGTGTGATGCAAGCATGGCAGTTGTCCATC AGCCAATAAACTTCAAATTGACTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_021710
• ORF Size: 435 bp
• Insert Size: 435
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC053339, AAH53339
• RefSeq Size: 895
• RefSeq ORF: 435
• Locus ID: 11782
• Gene Summary: This gene encodes the sigma subunit of the adaptor-related protein complex 4 which mediates intracellular membrane trafficking along the endocytic and secretory transport pathways. This complex contains four subunits, beta, epsilon, mu, and sigma, and belongs to a family of five adapter protein complexes, including three clathrin-associated complexes and two non clathrin-associated complexes, that localize to different intracellular compartments and mediate membrane vesicle trafficking using distinct pathways. In humans, loss-of-function mutations in this gene have been linked to specific adapter complex 4 deficiency disorders including hereditary spastic paraplegia. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
  Transcript Variant: This variant (2) uses two alternate splice sites in the 3' coding region, compared to variant 1, resulting in a novel 3' coding region and longer 3' UTR. It encodes isoform 2 which has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.