Fxyd5 (BC031112) Mouse Untagged Clone

CAT#: MC207063

Fxyd5 (untagged) - Mouse FXYD domain-containing ion transport regulator 5 (cDNA clone MGC:35841 IMAGE:4977085), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Fxyd5
• Synonyms: RIC, EF-8
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for BC031112, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCACTGTCCAGTCGCCTGTGTCTCCTCACTATTGTCGCCCTGATTCTGCCCAGCAGAGGGCAGACAC
  CAAAAAAGCCCACATCCATTTTTACAGCGGACCAGACTTCTGCGACTACTCGTGACAATGTCCCAGATCC
  AGATCAAACCAGCCCAGGAGTCCAGACCACCCCTCTCATCTGGACCAGAGAAGCAGAAGCCACAGGAAGC
  CAGACAGCAGCCCAAACCGAGACCCAGCAACTGACAAAAATGGCCACCTCGAATCCAGTGTCAGATCCAG
  GGCCACATACAAGCAGCAAGAAAGGTACCCCTGCAGTCTCCAGGATCGAGCCTCTCAGCCCATCCAAAAA
  CTTCATGCCTCCATCCTACATTGAACATCCACTGGATTCGAATGAGAACAACCCCTTCTACTACGATGAT
  ACTACCCTCCGGAAACGGGGACTGCTGGTGGCTGCGGTGCTGTTCATCACGGGAATTATCATTCTCACTA
  GTGAGAGTCGGGCATGGGCAGAAAGGGCAAGAAGGGGCTGGGGGCGGGCTGGGCTGCATGGTGACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: BC031112
• ORF Size: 963 bp
• Insert Size: 963
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC031112
• RefSeq Size: 2995
• RefSeq ORF: 963
• Locus ID: 18301
• Gene Summary: This gene encodes a precursor protein that is member of the FXYD family of transmembrane glycoproteins. Like most members of the FXYD family, the encoded protein is a subunit of the sodium-potassium adenosine triphosphatase pump. FXYD family members have tissue-specific expression and differentially regulate the activity of this pump. The protein encoded by this gene also plays a role in cell adhesion and motility. The orthologous human protein inhibits epithelial cadherin, a calcium-dependent adhesion protein and is associated with cancer (promotes metastasis). Alternative splicing of this mouse gene results in multiple transcript variants. [provided by RefSeq, Dec 2013]