Mafk (NM_010757) Mouse Untagged Clone

CAT#: MC207325

Mafk (untagged) - Mouse v-maf musculoaponeurotic fibrosarcoma oncogene family, protein K (avian) (Mafk), (10ug)


  "NM_010757" in other vectors (6)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Mafk"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Mafk
Synonyms AW061068; NF-E2; Nfe2u
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207325 representing NM_010757
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACGACTAATCCCAAGCCCAACAAGGCATTGAAGGTCAAGAAGGAGGCGGGTGAGAACGCCCCTGTTC
TTAGCGATGATGAGCTGGTGTCCATGTCAGTGCGGGAGCTAAACCAGCACCTGCGGGGGCTCACCAAGGA
GGAGGTCACTCGGCTGAAGCAGCGGCGGCGCACACTCAAGAACAGAGGCTACGCGGCTAGCTGTCGCATC
AAGCGTGTGACACAGAAAGAGGAGCTGGAACGGCAGCGTGTGGAGCTACAGCAGGAGGTGGAGAAGCTGG
CTCGAGAGAACAGCAGCATGCGGCTGGAGCTAGATGCCCTGCGCTCCAAGTATGAGGCCCTACAGACCTT
CGCTCGCACCGTGGCCCGAGGGCCTGTCACACCCACCAAGGTGGCCACCACCAGTGTCATCACCATCGTC
AAATCTGCCGAGCTCTCCTCCACCTCTGTACCCTTCTCAGCCGCCTCCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_010757
ORF Size 471 bp
Insert Size 471
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_010757.2, NP_034887.1
RefSeq Size 2825
RefSeq ORF 471
Locus ID 17135
Gene Summary Since they lack a putative transactivation domain, the small Mafs behave as transcriptional repressors when they dimerize among themselves. However, they seem to serve as transcriptional activators by dimerizing with other (usually larger) basic-zipper proteins and recruiting them to specific DNA-binding sites. Small Maf proteins heterodimerize with Fos and may act as competitive repressors of the NF-E2 transcription factor. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.