Cldn16 (NM_053241) Mouse Untagged Clone

CAT#: MC212266

Cldn16 (untagged) - Mouse claudin 16 (Cldn16), (10ug)


  "NM_053241" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cldn16"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cldn16
Synonyms claudin-16; PCLN1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212266 representing NM_053241
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGGATCTTCTTCAGTACGCTGCCTGCTTCTTGGCCATATTCTCCACTGGGTTTTTGATCGTGGCCA
CCTGGACAGACTGTTGGATGGTGAACGCTGATGACTCCCTGGAGGTGAGCACTAAATGCAGAGGCCTGTG
GTGGGAGTGTGTAACAAACGCTTTTGATGGGATTCGAACCTGCGATGAGTACGACTCCATATATGCAGAA
CATCCCTTGAAGCTGGTGGTAACTCGAGCACTGATGATCACAGCTGACATTTTAGCTGGCTTTGGATTCA
TCACCCTGCTCCTTGGTCTGGACTGTGTGAAGTTCCTACCTGATGACCCACAAATTAAAGTCCGCCTTTG
CTTTGTTGCAGGGACCACATTACTCATTGCAGGTACCCCAGGAATCATCGGTTCTGTGTGGTATGCTGTG
GATGTTTACGTCGAACGCTCCTCTCTCGTTTTACACAATATATTTCTTGGGATCCAATATAAATTTGGTT
GGTCCTGCTGGCTTGGAATGGCTGGGTCTTTGGGTTGCTTTTTGGCAGGAGCTCTCCTCACCTGCTGTTT
GTACCTCTTCAAAGATGTTGGGCCTGAGAGGAACTACCCTTATGCCATGAGGAAGCCCTATTCAACTGCA
GGTGTGTCCATGGCCAAGTCCTACAAGGCCCCTCGGACAGAGACAGCCAAAATGTATGCTGTAGACACCA
GAGTATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_053241
ORF Size 708 bp
Insert Size 708
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_053241.5, NP_444471.1
RefSeq Size 1173
RefSeq ORF 708
Locus ID 114141
Gene Summary This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is critical for renal paracellular epithelial transport of Ca(2+) and Mg(2+) in the thick ascending loop of Henle. The gene deficiency leads to specific alterations in renal Ca(2+) and Mg(2+) balance and also to disturbances in Na(+) handling. The interaction of this gene and the Cldn 19 gene is required for their assembly into tight junctions and for renal Mg(2+) reabsorption. This gene and the Cldn1 gene are clustered on chromosome 16. [provided by RefSeq, Aug 2010]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.