CGGBP1 (NM_001008390) Human Untagged Clone

CAT#: SC301283

CGGBP1 (untagged)-Human CGG triplet repeat binding protein 1 (CGGBP1), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CGGBP1
• Synonyms: CGGBP; p20-CGGBP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001008390, the custom clone sequence may differ by one or more nucleotides
  ATGGAGCGATTTGTAGTAACAGCACCACCTGCTCGAAACCGTTCTAAGACTGCTTTGTAT
  GTGACTCCCCTGGATCGAGTCACTGAGTTTGGAGGTGAGCTGCATGAAGATGGAGGAAAA
  CTCTTCTGCACTTCTTGCAATGTGGTTCTGAATCATGTTCGCAAGTCTGCCATTAGTGAC
  CACCTCAAGTCAAAGACTCATACCAAGAGGAAGGCAGAATTTGAAGAGCAGAATGTGAGA
  AAGAAGCAGAGGCCCCTAACTGCATCTCTTCAGTGCAACAGTACTGCGCAAACAGAGAAA
  GTCAGTGTTATCCAGGACTTTGTGAAAATGTGCCTGGAAGCCAACATCCCACTTGAGAAG
  GCTGATCACCCAGCAGTCCGTGCTTTCCTATCTCGCCATGTGAAGAATGGAGGCTCCATA
  CCTAAGTCAGACCAGCTACGGAGGGCATATCTTCCTGATGGATATGAGAATGAGAATCAA
  CTCCTCAACTCACAAGATTGTTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001008390
• ORF Size: 504 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001008390.1, NP_001008391.1
• RefSeq Size: 4608
• RefSeq ORF: 504
• Locus ID: 8545
• Gene Summary: This gene encodes a CGG repeat-binding protein that primarily localizes to the nucleus. CGG trinucleotide repeats are implicated in many disorders as they often act as transcription- and translation-regulatory elements, can produce hairpin structures which cause DNA replication errors, and form regions prone to chromosomal breakage. CGG repeats are also targets for CpG methylation. In addition to its ability to bind CGG repeats and regulate transcription, this gene is believed to play a role in DNA damage repair and telomere protection. In vitro studies indicate this protein does not bind to methylated CpG sequences. [provided by RefSeq, Jul 2017]
  Transcript Variant: This variant (1) represents the longest transcript. All three variants encode the same protein.