TMEM158 (NM_015444) Human Untagged Clone

CAT#: SC304318

TMEM158 (untagged)-Human transmembrane protein 158 (gene/pseudogene) (TMEM158)


  "NM_015444" in other vectors (6)

Reconstitution Protocol

USD 660.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "TMEM158"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TMEM158
Synonyms BBP; p40BBP; RIS1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_015444 edited
ATGCTGCCCCTGCTCGCCGCGCTCCTGGCCGCCGCCTGCCCGCTGCCGCCCGTCCGCGGC
GGGGCCGCGGACGCGCCCGGCCTCCTCGGGGTGCCCTCCAATGCTTCAGTCAACGCGTCC
TCCGCGGACGAGCCCATCGCCCCGCGGCTGCTGGCCTCGGCGGCCCCCGGGCCCCCCGAG
CGCCCGGGCCCGGAGGAGACGGCGGCGGCAGCGGCGCCGTGCAACATCAGCGTGCAGCGG
CAGATGCTGAGCTCGCTGCTCGTGCGCTGGGGCCGCCCGCGGGGCTTCCAGTGCGACCTA
CTGCTCTTCTCCACCAACGCGCACGGCCGCGCTTTCTTCGCCGCCGCCTTCCACCGCGTC
GGGCCGCCGCTGCTCATCGAGCACCTGGGGCTGGCGGCGGGCGGCGCGCAGCAGGACCTG
CGCCTCTGCGTGGGCTGCGGCTGGGTGCGCGGTCGCCGCACTGGCCGCCTCCGGCCCGCC
GCCGCCCCCAGCGCCGCCGCCGCCACCGCCGGGGCGCCCACCGCGCTGCCAGCCTACCCC
GCGGCCGAGCCGCCCGGGCCGCTGTGGCTGCAGGGCGAGCCGCTGCATTTCTGCTGCCTA
GACTTCAGCCTGGAGGAGCTGCAGGGCGAGCCGGGCTGGCGGCTGAACCGTAAGCCCATT
GAGTCCACGCTGGTGGCCTGCTTCATGACCCTGGTCATCGTGGTGTGGAGCGTGGCCGCC
CTCATCTGGCCGGTGCCCATCATCGCCGGCTTCCTGCCCAACGGCATGGAACAGCGCCGG
ACCACCGCCAGCACCACCGCAGCCACCCCCGCCGCAGTGCCCGCAGGGACCACCGCAGCC
GCCGCCGCCGCCGCCGCTGCCGCCGCCGCCGCGGCCGTCACTTCGGGGGTGGCGACCAAG
TGA
Restriction Sites Please inquire     
ACCN NM_015444
ORF Size 903 bp
Insert Size 2000
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation It is not a varient.
Reference Data
RefSeq NM_015444.1, NP_056259.1
RefSeq Size 1797
RefSeq ORF 903
Locus ID 25907
Protein Families Druggable Genome
Gene Summary Constitutive activation of the Ras pathway triggers an irreversible proliferation arrest reminiscent of replicative senescence. Transcription of this gene is upregulated in response to activation of the Ras pathway, but not under other conditions that induce senescence. The encoded protein is similar to a rat cell surface receptor proposed to function in a neuronal survival pathway. An allelic polymorphism in this gene results in both functional and non-functional (frameshifted) alleles; the reference genome represents the functional allele. [provided by RefSeq, Jul 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.