SIGLECL1 (SIGLEC12) (NM_033329) Human Untagged Clone

CAT#: SC305613

SIGLEC12 (untagged)-Human sialic acid binding Ig-like lectin 12 (SIGLEC12), transcript variant 2


  "NM_033329" in other vectors (4)

Reconstitution Protocol

USD 810.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SIGLEC12"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SIGLEC12
Synonyms S2V; Siglec-XII; SIGLECL1; SLG
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_033329, the custom clone sequence may differ by one or more nucleotides


ATGCTGCTGCCCCTGCTATGGGCAAATGAAGAGAGGGACAGTGGGGGCTGGGCTGACCCTCGTTTCTCCA
CAGCGTCCCAGGACCTACTGTCAAGATACAGGCTGGAGGTGCCAGAGTCGGTGACTGTGCAGGAGGGTCT
GTGTGTCTCTGTGCCCTGCAGTGTCCTTTACCCCCATTACAACTGGACTGCCTCTAGCCCTGTTTATGGA
TCCTGGTTCAAGGAAGGGGCCGATATACCATGGGATATTCCAGTGGCCACAAACACCCCAAGTGGAAAAG
TGCAAGAGGATACCCACGGTCGATTCCTCCTCCTTGGGGACCCACAGACCAACAACTGCTCCCTGAGCAT
CAGAGATGCCAGGAAGGGGGATTCAGGGAAGTACTACTTCCAGGTGGAGAGAGGAAGCAGGAAATGGAAC
TACATATATGACAAGCTCTCTGTGCATGTGACAGCCCTGACTCACATGCCCACCTTCTCCATCCCGGGGA
CCCTGGAGTCTGGCCACCCCAGGAACCTGACCTGCTCTGTGCCCTGGGCCTGTGAACAGGGGACGCCCCC
CACGATCACCTGGATGGGGGCCTCCGTGTCCTCCCTGGACCCCACTATCACTCGCTCCTCGATGCTCAGC
CTCATCCCACAGCCCCAGGACCATGGCACCAGCCTCACCTGTCAGGTGACCTTGCCTGGGGCCGGCGTGA
CCATGACCAGGGCTGTCCGACTCAACATATCCTATCCTCCTCAGAACTTGACCATGACTGTCTTCCAAGG
AGATGGCACAGCATCCACAACCTTGAGGAATGGCTCGGCCCTTTCAGTCCTGGAGGGCCAGTCCCTGCAC
CTTGTCTGTGCTGTCGACAGCAATCCCCCTGCCAGGCTGAGCTGGACCTGGGGGAGCCTGACCCTGAGCC
CCTCACAGTCCTCGAACCTTGGGGTGCTGGAGCTGCCTCGAGTGCATGTGAAGGATGAAGGGGAATTCAC
CTGCCGAGCTCAGAACCCTCTAGGCTCCCAGCACATTTCCCTGAGCCTCTCCCTGCAAAACGAGTACACA
GGCAAAATGAGGCCTATATCAGGAGTGACGCTAGGGGCATTCGGGGGAGCTGGAGCCACAGCCCTGGTCT
TCCTGTACTTCTGCATCATCTTCGTTGTAGTGAGGTCCTGCAGGAAGAAATCGGCAAGGCCAGCAGTGGG
CGTGGGGGATACAGGCATGGAGGACGCAAACGCTGTCAGGGGCTCAGCCTCTCAGGGACCCCTGATTGAA
TCCCCGGCAGATGACAGCCCCCCACACCATGCTCCGCCAGCCCTGGCCACCCCCTCCCCAGAGGAAGGAG
AGATCCAGTATGCATCCCTCAGCTTCCACAAAGCGAGGCCTCAGTACCCACAGGAACAGGAGGCCATCGG
CTATGAGTACTCCGAGATCAACATCCCCAAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_033329
ORF Size 1434 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_033329.2, NP_201586.1
RefSeq Size 1868
RefSeq ORF 1434
Locus ID 89858
Protein Families Druggable Genome, Stem cell - Pluripotency, Transmembrane
Gene Summary Sialic acid-binding immunoglobulin-like lectins (SIGLECs) are a family of cell surface proteins belonging to the immunoglobulin superfamily. They mediate protein-carbohydrate interactions by selectively binding to different sialic acid moieties present on glycolipids and glycoproteins. This gene encodes a member of the SIGLEC3-like subfamily of SIGLECs. Members of this subfamily are characterized by an extracellular V-set immunoglobulin-like domain followed by two C2-set immunoglobulin-like domains, and the cytoplasmic tyrosine-based motifs ITIM and SLAM-like. The encoded protein, upon tyrosine phosphorylation, has been shown to recruit the Src homology 2 domain-containing protein-tyrosine phosphatases SHP1 and SHP2. It has been suggested that the protein is involved in the negative regulation of macrophage signaling by functioning as an inhibitory receptor. This gene is located in a cluster with other SIGLEC3-like genes on 19q13.4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (2), also known as SLG-Short (SLG-S), differs in the 5' UTR and uses an alternate segment in the 5' coding region compared to variant 1, resulting in the use of an alternate in-frame translation initiation codon. It encodes an isoform (b) with a different and shorter N-terminus compared to isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.