GPLD1 (NM_177483) Human Untagged Clone

CAT#: SC307100

GPLD1 (untagged)-Human glycosylphosphatidylinositol specific phospholipase D1 (GPLD1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GPLD1
• Synonyms: GPIPLD; GPIPLDM; MGC22590; PIGPLD; PIGPLD1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_177483, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCTGCTTTCAGGTTGTGGCCTGGCCTGCTGATCATGTTGGGTTCTCTCTGCCATAGAGGTTCACCGT
  GTGGCCTTTCAACACACGTAGAAATAGGACACAGAGCTCTGGAGTTTCTTCAGCTTCACAATGGGCGTGT
  TAACTACAGAGAGCTGTTACTAGAACACCAGGATGCGTATCAGGCTGGAATCGTGTTTCCTGATTGTTTT
  TACCCTAGCATCTGCAAAGGAGGAAAATTCCATGATGTGTCTGAGAGCACTCACTGGACTCCGTTTCTTA
  ATGCAAGCGTTCATTATATCCGAGAGAACTATCCCCTTCCCTGGGAGAAGGACACAGAGAAACTGGTAGC
  TTTCTTGTTTGGAATTACTTCTCACATGGCGGCAGATGTCAGCTGGCATAGTCTGGGCCTTGAACAAGGA
  TTCCTTAGGACCATGGGAGCTATTGATTTTCACGGCTCCTATTCAGAGGCTCATTCGGCTGGTGATTTTG
  GTACTGTTTATTTACATTTGCTAAATTTTCTCGTGGTATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_177483
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_177483.1, NP_803436.1
• RefSeq Size: 1096 bp
• RefSeq ORF: 531 bp
• Locus ID: 2822
• Cytogenetics: 6p22.3
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Glycosylphosphatidylinositol(GPI)-anchor biosynthesis
• Gene Summary: 'Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) differs in the 5' UTR and uses an alternate splice site in the 3' coding region, compared to variant 1. This results in a protein (isoform 2) with a shorter C-terminus, compared to isoform 1.