SELS (SELENOS) (NM_203472) Human Untagged Clone

CAT#: SC308201

VIMP (untagged)-Human selenoprotein S (SELS), transcript variant 1 (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)

Specifications

Product Data

• Type: Human Untagged Clone
• Symbol: SELENOS
• Synonyms: AD-015; ADO15; SBBI8; SELS; SEPS1; VIMP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_203472, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAACGCCAAGAGGAGTCTCTGTCCGCGCGGCCGGCCCTGGAGACCGAGGGGCTGCGCTTCCTGCACA
  CCACGGTGGGCTCCCTGCTGGCCACCTATGGCTGGTACATCGTCTTCAGCTGCATCCTTCTCTACGTGGT
  CTTTCAGAAGCTTTCCGCCCGGCTAAGAGCCTTGAGGCAGAGGCAGCTGGACCGAGCTGCGGCTGCTGTG
  GAACCTGATGTTGTTGTTAAACGACAAGAAGCTTTAGCAGCTGCTCGACTGAAAATGCAAGAAGAACTAA
  ATGCGCAAGTTGAAAAGCATAAGGAAAAACTGAAACAACTTGAAGAAGAAAAAAGGAGACAGAAGATTGA
  AATGTGGGACAGCATGCAAGAAGGAAAAAGTTACAAAGGAAATGCAAAGAAGCCCCAGGAGGAAGACAGT
  CCTGGGCCTTCCACTTCATCTGTCCTGAAACGGAAATCGGACAGAAAGCCTTTGCGGGGAGGAGGTTATA
  ACCCGTTGTCTGGTGAAGGAGGCGGAGCTTGCTCCTGGAGACCTGGACGCAGAGGCCCGTCATCTGGCGG
  ATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_203472
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
• OTI Annotation: This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins.

Reference Data

• RefSeq: NM_203472.2, NP_982298.2
• RefSeq Size: 1417
• Locus ID: 55829
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a transmembrane protein that is localized in the endoplasmic reticulum (ER). It is involved in the degradation process of misfolded proteins in the ER, and may also have a role in inflammation control. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Two additional phylogenetically conserved stem-loop structures (Stem-loop 1 and Stem-loop 2) in the 3' UTR of this mRNA have been shown to function as modulators of Sec insertion. An alternatively spliced transcript variant, lacking the SECIS element and encoding a non-Sec containing shorter isoform, has been described for this gene (PMID:23614019). [provided by RefSeq, Jul 2017]
  Transcript Variant: This variant (2) is alternatively spliced at the 3' end compared to variant 1, and lacks a selenocysteine (Sec) insertion sequence (SECIS) element in its 3' UTR, which is necessary for the recognition of UGA as a Sec codon. This results in translation termination at the UGA codon and a non-Sec containing shorter isoform (2) compared to isoform 1 (PMID:23614019).