DACH1 (NM_080760) Human Untagged Clone

CAT#: SC313997

DACH1 (untagged)-Human dachshund homolog 1 (Drosophila) (DACH1), transcript variant 2


  "NM_080760" in other vectors (5)

Reconstitution Protocol

USD 950.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "DACH1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DACH1
Synonyms DACH
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC313997 sequence for NM_080760 edited (data generated by NextGen Sequencing)


ATGGCAGTGCCGGCGGCTTTGATCCCTCCGACCCAGCTGGTCCCCCCTCAACCCCCAATCTCCACGTCTG
CTTCCTCCTCTGGCACCACCACCTCCACCTCTTCGGCGACTTCGTCTCCGGCTCCTTCCATCGGACCCCC
GGCGTCCTCTGGGCCAACTCTGTTCCGCCCGGAGCCCATCGCTTCGGCGGCGGCGGCGGCGGCCACAGTC
ACCTCTACCGGCGGCGGCGGCGGCGGCGGCGGCAGCGGAGGCGGCGGCGGCAGCAGCGGCAACGGAGGCG
GCGGTGGCGGCGGCGGCGGTGGCAGCAACTGCAACCCCAACCTGGCGGCCGCGAGCAACGGCAGCGGCGG
CGGCGGCGGCGGCATCAGCGCTGGCGGCGGCGTCGCTTCCAGCACCCCCATCAACGCCAGCACCGGCAGC
AGCAGCAGCAGCAGTAGCAGCAGCAGCAGCAGCAGCAGTAGTAGCAGCAGCAGCAGTAGCAGCAGCAGCT
GCGGCCCCCTCCCCGGGAAACCCGTGTACTCAACCCCGTCCCCAGTGGAAAACACCCCTCAGAATAATGA
GTGCAAAATGGTGGATCTGAGGGGGGCCAAAGTGGTTTCCTTCACGGTGGAGGGCTGCGAGCTGATCTGC
CTGCCCCAGGCTTTCGACCTGTTCCTGAAGCACTTGGTGGGGGGCTTGCATACGGTCTACACCAAGCTGA
AGCGGCTGGAGATCACGCCGGTGGTGTGCAATGTGGAACAAGTTCGCATCCTGAGGGGACTGGGCGCCAT
CCAGCCAGGAGTGAACCGCTGCAAACTCATCTCCAGGAAGGACTTCGAGACCCTCTACAATGACTGCACC
AACGCAAGTTCTAGACCTGGAAGGCCTCCTAAGAGGACTCAAAGTGTCACCTCCCCAGAGAACTCTCACA
TCATGCCGCATTCTGTCCCTGGTCTCATGTCTCCTGGGATAATTCCACCAACAGGTCTGACAGCAGCCGC
TGCAGCAGCTGCTGCTGCTACCAATGCAGCTATTGCTGAAGCAATGAAGGTGAAAAAAATCAAATTAGAA
GCCATGAGCAACTATCATGCCAGTAATAACCAACATGGAGCAGACTCTGAAAACGGGGACATTTTTTTAA
TTTTAGTTGTTACACCGAGTTCTACACCAACCGCAAGAGACAGCCTTGACAAACTCTCTCTAACTGGGCA
TGGACAACCACTGCCTCCAGGTTTTCCATCTCCTTTTCTGTTTCCTGATGGACTGTCTTCCATCGAGACT
CTTCTGACTAACATACAGGGGCTGTTGAAAGTTGCCATAGATAATGCCAGAGCTCAAGAGAAACAGGTCC
AACTGGAAAAAACTGAGCTGAAGATGGATTTTTTAAGGGAAAGAGAACTAAGGGAAACACTTGAGAAGCA
GTTGGCTATGGAACAAAAGAATAGAGCCATAGTTCAAAAGAGGCTAAAGAAGGAGAAGAAGGCAAAGAGA
AAATTGCAGGAAGCACTTGAGTTTGAGACGAAACGGCGTGAACAAGCAGAACAGACGCTAAAACAGGCAG
CTTCAACAGATAGTCTCAGGGTCTTAAATGACTCTCTGACCCCAGAGATAGAGGCTGACCGCAGTGGCGG
CAGAACAGATGCTGAAAGGACAATACAAGATGGAAGACTGTATTTGAAAACTACTGTCATGTACTGA


Clone variation with respect to NM_080760.5
596:t=>c 1113:t=>g 1114:t=>a 1115:t=>a 1118:t=>c 1121:t=>g 1123:t=>g 1125:a=>c 1127:t=>a 1130:t=>a 1131:t=>g 1134:a=>c 1138:a=>c 1139:g=>t
Restriction Sites Please inquire     
ACCN NM_080760
Insert Size 2000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this clone has been fully sequenced and found one SNP within the protein associated with this reference, NM_080760.3.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_080760.3, NP_542938.1
RefSeq Size 4796 bp
RefSeq ORF 1677 bp
Locus ID 1602
Cytogenetics 13q21.33
Domains Ski_Sno
Protein Families Transcription Factors
Gene Summary 'This gene encodes a chromatin-associated protein that associates with other DNA-binding transcription factors to regulate gene expression and cell fate determination during development. The protein contains a Ski domain that is highly conserved from Drosophila to human. Expression of this gene is lost in some forms of metastatic cancer, and is correlated with poor prognosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]'
Transcript Variant: This variant (2) lacks three consecutive coding exons but maintains the same reading frame, compared to variant 1. The resulting isoform (b) is shorter than isoform a. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence because a full-length transcript was not available for this variant. The genomic coordinates used for the transcript record were based on RT-PCR data reported in PMID:11543628.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.