PAICS (NM_001079525) Human Untagged Clone
CAT#: SC315553
PAICS (untagged)-Human phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase (PAICS), transcript variant 1
"NM_001079525" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PAICS |
Synonyms | ADE2; ADE2H1; AIRC; PAIS |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001079525, the custom clone sequence may differ by one or more nucleotides
ATGGCGACAGCTGAGGTACTGAACATTGGTAAAAAATTATATGAGGGTAAAACAAAAGAAGTCTACGAAT TGTTAGACAGTCCAGGAAAAGTCCTCCTGCAGTCCAAGGACCAGATTACAGCAGGAAATGCAGCTAGAAA AAACCACCTGGAAGGAAAAGCTGCAATCTCAAATAAAATCACCAGTTGTATTTTTCAGTTATTACAGGAA GCAGTTACCTCATATAAGTCAAATCGTATTAAAACTGCCTTCACCAGAAAATGTGGGGAGACAGCTTTCA TTGCACCGCAGTGTGAAATGATTCCAATTGAATGGGTTTGCAGAAGAATAGCAACTGGTTCTTTTCTCAA AAGAAATCCTGGTGTCAAGGAAGGATATAAGTTTTACCCACCTAAAGTGGAGTTGTTTTTCAAGGATGAT GCCAATAATGACCCACAGTGGTCTGAGGAACAGCTGATTGCTGCAAAATTTTGCTTTGCTGGACTTCTTA TAGGCCAGACTGAAGTGGATATCATGAGTCATGCTACACAGGCTATATTTGAAATACTGGAGAAATCCTG GTTGCCCCAGAATTGTACACTGGTTGATATGAAGATTGAATTTGGTGTTGATGTAACCACCAAAGAAATT GTTCTTGCTGATGTTATTGACAATGATTCCTGGAGACTCTGGCCATCAGGAGATCGAAGCCAACAGAAAG ACAAACAGTCTTATCGGGACCTCAAAGAAGTAACTCCTGAAGGGCTCCAAATGGTAAAGAAAAACTTTGA GTGGGTTGCAGAGAGAGTAGAGTTGCTTTTGAAATCAGAAAGTCAGTGCAGGGTTGTAGTGTTGATGGGC TCTACTTCTGATCTTGGTCACTGTGAAAAAATCAAGAAGGCCTGTGGAAATTTTGGCATTCCATGTGAAC TTCGAGTAACATCTGCGCATAAAGGACCAGATGAAACTCTGAGGATTAAAGCTGAGTATGAAGGGGATGG CATTCCTACTGTATTTGTGGCAGTGGCAGGCAGAAGTAATGGTTTGGGACCAGTGATGTCTGGGAACACT GCATATCCAGTTATCAGCTGTCCTCCCCTCACACCAGACTGGGGAGTTCAGGATGTGTGGTCTTCTCTTC GACTACCCAGTGGTCTTGGCTGTTCAACCGTACTTTCTCCAGAAGGATCAGCTCAATTTGCTGCTCAGAT ATTTGGGTTAAGCAACCATTTGGTATGGAGCAAACTGCGAGCAAGCATTTTGAACACATGGATTTCCTTG AAGCAGGCTGACAAGAAAATCAGAGAATGTAATTTATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001079525 |
ORF Size | 1299 bp |
Insert Size | 0 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001079525.1, NP_001072993.1 |
RefSeq Size | 3350 |
RefSeq ORF | 1299 |
Locus ID | 10606 |
Protein Families | Druggable Genome |
Protein Pathways | Metabolic pathways, Purine metabolism |
Gene Summary | This gene encodes a bifunctional enzyme containing phosphoribosylaminoimidazole carboxylase activity in its N-terminal region and phosphoribosylaminoimidazole succinocarboxamide synthetase in its C-terminal region. It catalyzes steps 6 and 7 of purine biosynthesis. The gene is closely linked and divergently transcribed with a locus that encodes an enzyme in the same pathway, and transcription of the two genes is coordinately regulated. The human genome contains several pseudogenes of this gene. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents one of the longest transcripts and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223925 | PAICS (Myc-DDK-tagged)-Human phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase (PAICS), transcript variant 1 |
USD 420.00 |
|
RG223925 | PAICS (GFP-tagged) - Human phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase (PAICS), transcript variant 1 |
USD 460.00 |
|
RC223925L1 | Lenti ORF clone of Human phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase (PAICS), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC223925L2 | Lenti ORF clone of Human phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase (PAICS), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC223925L3 | Lenti ORF clone of Human phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase (PAICS), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC223925L4 | Lenti ORF clone of Human phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase (PAICS), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review