GPR105 (P2RY14) (NM_001081455) Human Untagged Clone

CAT#: SC315940

P2RY14 (untagged)-Human purinergic receptor P2Y, G-protein coupled, 14 (P2RY14), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: P2RY14
• Synonyms: BPR105; GPR105; P2Y14
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001081455, the custom clone sequence may differ by one or more nucleotides
  ATGATCAATTCAACCTCCACACAGCCTCCAGATGAATCCTGCTCTCAGAACCTCCTGATC
  ACTCAGCAGATCATTCCTGTGCTGTACTGTATGGTCTTCATTGCAGGAATCCTACTCAAT
  GGAGTGTCAGGATGGATATTCTTTTACGTGCCCAGCTCTAAGAGTTTCATCATCTATCTC
  AAGAACATTGTTATTGCTGACTTTGTGATGAGCCTGACTTTTCCTTTCAAGATCCTTGGT
  GACTCAGGCCTTGGTCCCTGGCAGCTGAACGTGTTTGTGTGCAGGGTCTCTGCCGTGCTC
  TTCTACGTCAACATGTACGTCAGCATTGTGTTCTTTGGGCTCATCAGCTTTGACAGATAT
  TATAAAATTGTAAAGCCTCTTTGGACTTCTTTCATCCAGTCAGTGAGTTACAGCAAACTT
  CTGTCAGTGATAGTATGGATGCTCATGCTCCTCCTTGCTGTTCCAAATATTATTCTCACC
  AACCAGAGTGTTAGGGAGGTTACACAAATAAAATGTATAGAACTGAAAAGTGAACTGGGA
  CGGAAGTGGCACAAAGCATCAAACTACATCTTCGTGGCCATCTTCTGGATTGTGTTTCTT
  TTGTTAATCGTTTTCTATACTGCTATCACAAAGAAAATCTTTAAGTCCCACCTTAAGTCA
  AGTCGGAATTCCACTTCGGTCAAAAAGAAATCTAGCCGCAACATATTCAGCATCGTGTTT
  GTGTTTTTTGTCTGTTTTGTACCTTACCATATTGCCAGAATCCCCTACACAAAGAGTCAG
  ACCGAAGCTCATTACAGCTGCCAGTCAAAAGAAATCTTGCGGTATATGAAAGAATTCACT
  CTGCTACTATCTGCTGCAAATGTATGCTTGGACCCTATTATTTATTTCTTTCTATGCCAG
  CCGTTTAGGGAAATCTTATGTAAGAAATTGCACATTCCATTAAAAGCTCAGAATGACCTA
  GACATTTCCAGAATCAAAAGAGGAAATACAACACTTGAAAGCACAGATACTTTG
  
• Restriction Sites: Please inquire
• ACCN: NM_001081455
• ORF Size: 1017 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001081455.1, NP_001074924.1
• RefSeq Size: 2694
• RefSeq ORF: 1017
• Locus ID: 9934
• Protein Families: Druggable Genome, GPCR, Transmembrane
• Protein Pathways: Neuroactive ligand-receptor interaction
• Gene Summary: The product of this gene belongs to the family of G-protein coupled receptors, which contains several receptor subtypes with different pharmacological selectivity for various adenosine and uridine nucleotides. This receptor is a P2Y purinergic receptor for UDP-glucose and other UDP-sugars coupled to G-proteins. It has been implicated in extending the known immune system functions of P2Y receptors by participating in the regulation of the stem cell compartment, and it may also play a role in neuroimmune function. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.