RDHE2 (SDR16C5) (NM_138969) Human Untagged Clone

CAT#: SC317463

SDR16C5 (untagged)-Human short chain dehydrogenase/reductase family 16C, member 5 (SDR16C5)


  "NM_138969" in other vectors (5)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SDR16C5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SDR16C5
Synonyms EPHD-2; RDH#2; RDH-E2; RDHE2; retSDR2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_138969, the custom clone sequence may differ by one or more nucleotides


ATGTCTTTCAACCTGCAATCATCAAAGAAACTGTTCATTTTCTTAGGAAAATCACTGTTTAGTCTTCTGG
AGGCTATGATTTTTGCCTTACTCCCAAAGCCACGGAAGAACGTTGCTGGTGAAATAGTCCTCATCACAGG
TGCTGGAAGTGGACTCGGAAGGCTCTTAGCCTTGCAGTTTGCCCGGCTGGGATCTGTTCTTGTTCTCTGG
GATATCAATAAGGAGGGGAATGAGGAAACATGTAAGATGGCTCGGGAAGCTGGAGCCACAAGAGTGCACG
CCTATACCTGCGATTGCAGCCAAAAGGAAGGAGTGTATAGAGTAGCCGACCAGGTTAAAAAAGAAGTCGG
CGATGTTTCCATCCTAATCAACAATGCCGGAATCGTAACAGGCAAAAAGTTCCTTGACTGTCCAGATGAG
CTTATGGAAAAGTCATTTGATGTGAATTTCAAAGCACATTTATGGACTTATAAAGCCTTTCTACCTGCTA
TGATTGCTAATGACCATGGACATTTGGTTTGCATTTCAAGTTCAGCTGGATTAAGTGGAGTAAATGGGCT
GGCAGATTACTGTGCAAGTAAATTTGCAGCCTTTGGGTTTGCTGAATCTGTATTTGTAGAAACATTTGTC
CAAAAACAAAAGGGGATCAAAACCACGATTGTGTGCCCCTTTTTTATAAAAACTGGAATGTTTGAAGGTT
GTACTACAGGCTGTCCTTCTCTGTTGCCAATTCTGGAACCAAAATATGCAGTTGAAAAAATAGTAGAAGC
TATTCTACAAGAAAAAATGTACTTGTATATGCCAAAGTTGTTATACTTCATGATGTTTCTTAAAAGCTTT
TTGCCCCTCAAGACAGGACTGCTTATAGCTGACTATTTGGGCATCCTTCATGCAATGGATGGCTTTGTTG
ACCAAAAGAAGAAGCTCTAA


Restriction Sites SgfI-MluI     
ACCN NM_138969
ORF Size 930 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_138969.3, NP_620419.2
RefSeq Size 3535
RefSeq ORF 930
Locus ID 195814
Protein Families Druggable Genome
Gene Summary This gene encodes a member of the short-chain alcohol dehydrogenase/reductase superfamily of proteins and is involved in the oxidation of retinol to retinaldehyde. The encoded protein is associated with the endoplasmic reticulum and is predicted to contain three transmembrane helices, suggesting that it is an integral membrane protein. It recognizes all-trans-retinol and all-trans-retinaldehyde as substrates and exhibits a strong preference for NAD(+)/NADH as cofactors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Transcript Variant: This variant (2) lacks an alternate exon in the 3' coding region compared to variant 1. It encodes isoform 2, which is shorter than and has a distinct C-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.