VAX1 (NM_001112704) Human Untagged Clone

CAT#: SC318830

VAX1 (untagged)-Human ventral anterior homeobox 1 (VAX1), transcript variant 1


  "NM_001112704" in other vectors (4)

Reconstitution Protocol

USD 570.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "VAX1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol VAX1
Synonyms MCOPS11
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001112704 edited
ATGTTCGGGAAACCAGACAAAATGGACGTTCGATGCCACTCGGACGCCGAGGCTGCCCGG
GTCTCGAAGAACGCGCACAAGGAGAGTCGGGAGAGCAAGGGCGCGGAGGGGAACCTCCCA
GCCGCCTTCCTCAAGGAGCCGCAGGGCGCCTTCTCAGCGTCGGGCGCTGCTGAGGATTGT
AACAAAAGTAAATCCAATTCCGCAGCGGACCCGGATTACTGCCGCCGGATCCTGGTCCGA
GATGCCAAGGGGTCCATCCGAGAGATCATCCTGCCCAAGGGCCTGGACTTGGACCGGCCT
AAGAGGACGCGCACGTCCTTCACCGCGGAGCAGCTCTATCGGCTGGAGATGGAGTTCCAG
CGCTGCCAGTACGTGGTGGGCCGCGAGAGGACCGAGCTCGCCCGGCAGCTTAACCTCTCC
GAGACCCAGGTGAAGGTCTGGTTCCAGAACCGGCGCACCAAGCAGAAGAAGGACCAGGGC
AAGGACTCGGAGCTACGCTCGGTGGTGTCGGAGACCGCGGCCACGTGCAGCGTGCTACGG
CTGCTGGAGCAGGGCCGCCTGTTGTCGCCGCCCGGCCTGCCTGCGCTGCTGCCGCCTTGC
GCCACGGGCGCTCTCGGCTCAGCGCTGCGCGGGCCCAGCTTGCCGGCCCTGGGCGCGGGC
GCCGCTGCAGGCTCGGCCGCCGCAGCCGCCGCCGCCGCCCCGGGCCCAGCGGGCGCTGCA
TCCCCGCACCCGCCGGCTGTGGGCGGTGCTCCAGGTCCCGGGCCCGCCGGGCCGGGGGGA
TTGCACGCAGGCGCCCCGGCCGCGGGCCACAGCCTCTTCAGCCTGCCGGTGCCCTCGCTG
CTCGGCTCCGTCGCCAGCCGCCTGTCCTCCGCCCCGTTAACAATGGCTGGTTCGCTAGCT
GGGAATTTGCAAGAACTCTCCGCCCGATATCTGAGCTCCTCGGCCTTCGAGCCTTACTCC
CGGACCAACAATAAAGAAGGGGCCGAGAAAAAAGCGCTGGACTGA
Restriction Sites Please inquire     
ACCN NM_001112704
ORF Size 1005 bp
Insert Size 1000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001112704.1, NP_001106175.1
RefSeq Size 1968
RefSeq ORF 1005
Locus ID 11023
Protein Families Transcription Factors
Gene Summary This gene encodes a homeo-domain containing protein from a class of homeobox transcription factors which are conserved in vertebrates. Genes of this family are involved in the regulation of body development and morphogenesis. The most conserved genes, called HOX genes are found in special gene clusters. This gene belongs to the VAX subfamily and lies in the vicinity of the EMX homeobox gene family. Another member of VAX family is located on chromosome 2. The encoded protein may play an important role in the development of anterior ventral forebrain and visual system. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes the longer isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by orthologous data.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.