Proteasome beta 1 (PSMB1) (NM_002793) Human Untagged Clone

CAT#: SC320589

PSMB1 (untagged)-Human proteasome (prosome, macropain) subunit, beta type, 1 (PSMB1)


  "NM_002793" in other vectors (5)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "PSMB1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PSMB1
Synonyms HC5; PMSB1; PSC5
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_002793.2 GAGACAGCAAGTGTCGGATCCGCAGGCGCAGCCGTGCGATGTTGTCCTCTACAGCCATGT
ATTCGGCTGCTGGCAGAGACTTGGGGATGGAACCGCACAGAGCCGCGGGCCCTTTGCAGC
TGCGATTTTCGCCCTACGTTTTCAACGGAGGTACTATACTGGCAATTGCTGGAGAAGATT
TTGCAATTGTTGCTTCTGATACTCGATTGAGTGAAGGGTTTTCAATTCATACGCGGGATA
GCCCCAAATGTTACAAATTAACAGACAAAACAGTCATTGGATGCAGCGGTTTTCATGGAG
ACTGTCTTACGCTGACAAAGATTATTGAAGCAAGACTAAAGATGTATAAGCATTCCAATA
ATAAGGCCATGACTACGGGGGCAATTGCTGCAATGCTGTCTACAATCCTGTATTCAAGGC
GCTTCTTTCCATACTATGTTTACAACATCATCGGTGGACTTGATGAAGAAGGAAAGGGGG
CTGTATACAGCTTTGATCCAGTAGGGTCTTACCAGAGAGACTCCTTCAAGGCTGGAGGCT
CAGCAAGTGCCATGCTACAGCCCCTGCTTGACAACCAGGTTGGTTTTAAGAACATGCAGA
ATGTGGAGCATGTTCCGCTGTCCTTGGACAGAGCCATGCGGCTGGTGAAAGATGTCTTCA
TTTCTGCGGCTGAGAGAGATGTGTACACTGGGGACGCACTCCGGATCTGCATAGTGACCA
AAGAGGGCATCAGGGAGGAAACTGTTTCCTTAAGGAAGGACTGATCTGTGTGCTCTTATC
ACCAATCAGTTCAGACCTGGTTGATTTTGTACTTTGGAACTGTACCTTGGATGGTTTTGT
TTATTAAAAGAGAAACCTGAAGTAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_002793
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002793.2, NP_002784.1
RefSeq Size 872 bp
RefSeq ORF 726 bp
Locus ID 5689
Cytogenetics 6q27
Domains proteasome
Protein Families Protease
Protein Pathways Proteasome
Gene Summary 'The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is tightly linked to the TBP (TATA-binding protein) gene in human and in mouse, and is transcribed in the opposite orientation in both species. [provided by RefSeq, Jul 2008]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.