Annexin VII (ANXA7) (NM_001156) Human Untagged Clone
CAT#: SC320695
ANXA7 (untagged)-Human annexin A7 (ANXA7), transcript variant 1
"NM_001156" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ANXA7 |
Synonyms | ANX7; SNX; SYNEXIN |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001156.2
CCGGGTTGGGCTGTGACGCTGCTGCTGGGGTCAGAATGTCATACCCAGGCTATCCCCCAA
CAGGCTACCCACCTTTCCCTGGATATCCTCCTGCAGGTCAGGAGTCATCTTTTCCCCCTT CTGGTCAGTATCCTTATCCTAGTGGCTTTCCTCCAATGGGAGGAGGTGCCTACCCACAAG TGCCAAGTAGTGGCTACCCAGGAGCTGGAGGCTACCCTGCGCCTGGAGGTTATCCAGCCC CTGGAGGCTATCCTGGTGCCCCACAGCCAGGGGGAGCTCCATCCTATCCCGGAGTTCCTC CAGGCCAAGGATTTGGAGTCCCACCAGGTGGAGCAGGCTTTTCTGGGTATCCACAGCCAC CTTCACAGTCTTATGGAGGTGGTCCAGCACAGGTTCCACTACCTGGTGGCTTTCCTGGAG GACAGATGCCTTCTCAGTATCCTGGAGGACAACCTACTTACCCTAGTCAGCCTGCCACAG TGACTCAGGTCACTCAAGGAACTATCCGACCAGCTGCCAACTTCGATGCTATAAGAGATG CAGAAATTCTTCGTAAGGCAATGAAGGGTTTTGGGACAGATGAGCAGGCAATTGTGGATG TGGTGGCCAACCGTTCCAATGATCAGAGGCAAAAAATTAAAGCAGCATTTAAGACCTCCT ATGGCAAGGATTTAATCAAAGATCTCAAATCAGAGTTAAGTGGAAATATGGAAGAACTGA TCCTGGCCCTCTTCATGCCTCCTACGTATTACGATGCCTGGAGCTTACGGAAAGCAATGC AGGGAGCAGGAACTCAGGAACGTGTATTGATTGAGATTTTGTGCACAAGAACAAATCAGG AAATCCGAGAAATTGTCAGATGTTATCAGTCAGAATTTGGACGAGACCTTGAAAAGGACA TTAGGTCAGATACATCAGGACATTTTGAACGTTTACTTGTGTCCATGTGCCAGGGAAATC GTGATGAGAACCAGAGTATAAACCACCAAATGGCTCAGGAAGATGCTCAGCGTCTCTATC AAGCTGGTGAGGGGAGACTAGGGACCGATGAATCTTGCTTTAACATGATCCTTGCCACAA GAAGCTTTCCTCAGCTGAGAGCTACCATGGAGGCTTATTCTAGGATGGCTAATCGAGACT TGTTAAGCAGTGTGAGCCGTGAGTTTTCCGGATATGTAGAAAGTGGTTTGAAGACCATCT TGCAGTGTGCCCTGAACCGCCCTGCCTTCTTTGCTGAGAGGCTCTACTATGCTATGAAAG GTGCTGGCACAGATGACTCCACCCTGGTCCGGATTGTGGTCACTCGAAGTGAGATTGACC TTGTACAAATAAAACAGATGTTCGCTCAGATGTATCAGAAGACTCTGGGCACAATGATTG CAGGTGACACGAGTGGAGATTACCGAAGACTTCTTCTGGCTATTGTGGGCCAGTAGGAGG GATTTTTTTTTTTTTAATGAAAAAAAATTTCTATTCATAGCTTATCCTTCAGAGCAATGA CCTGCATGCAGCAATATCAAACATCAGCTAACCGAAAGAGCTTTCTGTCAAGGACCGTAT CAGGGTAATGTGCTTGGTTTGCACATGTTGTTATTGCCTTAATTCTAATTTTATTTTGTT CTCTACATACAATCAATGTAAAGCCATATCACAATGATACAGTAATATTGCAATGTTTGT AAACCTTCATTCTTACTAGTTTCATTCTAATCAAGATGTCAAATTGAATAAAAATCACAG CAATCTCTGAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001156 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001156.2, NP_001147.1 |
RefSeq Size | 2110 bp |
RefSeq ORF | 1401 bp |
Locus ID | 310 |
Cytogenetics | 10q22.2 |
Domains | annexin |
Gene Summary | 'Annexin VII is a member of the annexin family of calcium-dependent phospholipid binding proteins.The Annexin VII gene contains 14 exons and spans approximately 34 kb of DNA. An alternatively spliced cassette exon results in two mRNA transcripts of 2.0 and 2.4 kb which are predicted to generate two protein isoforms differing in their N-terminal domain. The alternative splicing event is tissue specific and the mRNA containing the cassette exon is prevalent in brain, heart and skeletal muscle. The transcripts also differ in their 3'-non coding regions by the use of two alternative poly(A) signals. Annexin VII encodes a protein with a molecular weight of approximately 51 kDa with a unique, highly hydrophobic N-terminal domain of 167 amino acids and a conserved C-terminal region of 299 amino acids. The latter domain is composed of alternating hydrophobic and hydrophilic segments. Structural analysis of the protein suggests that Annexin VII is a membrane binding protein with diverse properties, including voltage-sensitive calcium channel activity, ion selectivity and membrane fusion. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (1) lacks an alternate in-frame exon, compared to variant 2, resulting in a shorter protein (isoform 1) that lacks an internal segment, compared to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments and orthologous data. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC126802 | ANXA7 (untagged)-Human annexin A7 (ANXA7), transcript variant 1 |
USD 310.00 |
|
RC201226 | ANXA7 (Myc-DDK-tagged)-Human annexin A7 (ANXA7), transcript variant 1 |
USD 420.00 |
|
RG201226 | ANXA7 (GFP-tagged) - Human annexin A7 (ANXA7), transcript variant 1 |
USD 460.00 |
|
RC201226L1 | Lenti ORF clone of Human annexin A7 (ANXA7), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC201226L2 | Lenti ORF clone of Human annexin A7 (ANXA7), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC201226L3 | Lenti ORF clone of Human annexin A7 (ANXA7), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC201226L4 | Lenti ORF clone of Human annexin A7 (ANXA7), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review